The Genomes of Oryza sativa: A History of Duplications

We report improved whole-genome shotgun sequences for the genomes of indica and japonica rice, both with multimegabase contiguity, or almost 1,000-fold improvement over the drafts of 2002. Tested against a nonredundant collection of 19,079 full-length cDNAs, 97.7% of the genes are aligned, without fragmentation, to the mapped super-scaffolds of one or the other genome. We introduce a gene identification procedure for plants that does not rely on similarity to known genes to remove erroneous predictions resulting from transposable elements. Using the available EST data to adjust for residual errors in the predictions, the estimated gene count is at least 38,000–40,000. Only 2%–3% of the genes are unique to any one subspecies, comparable to the amount of sequence that might still be missing. Despite this lack of variation in gene content, there is enormous variation in the intergenic regions. At least a quarter of the two sequences could not be aligned, and where they could be aligned, single nucleotide polymorphism (SNP) rates varied from as little as 3.0 SNP/kb in the coding regions to 27.6 SNP/kb in the transposable elements. A more inclusive new approach for analyzing duplication history is introduced here. It reveals an ancient whole-genome duplication, a recent segmental duplication on Chromosomes 11 and 12, and massive ongoing individual gene duplications. We find 18 distinct pairs of duplicated segments that cover 65.7% of the genome; 17 of these pairs date back to a common time before the divergence of the grasses. More important, ongoing individual gene duplications provide a never-ending source of raw material for gene genesis and are major contributors to the differences between members of the grass family

Halpe sikkima Moore 1882

<i>Halpe sikkima</i> Moore, 1882 (Fig. 1) <p> <i>Halpe sikkima</i> Moore, 1882: 407, TL: Sikkim; Elwes & Möller, 1888: 453; Evans, 1949: 260; Eliot, 1992: 350; Osada et al., 1999: 192; Yuan et al., 2007: 310; Ek-Amnuay, 2012: 828; Yuan et al., 2015: 397; Monastyrskii & Devyatkin, 2016: 77.</p> <p> <i>Halpe selangora</i> Swinhoe, 1913: 283, TL: Selangor, Malaya. Synonymised by Evans, 1949.</p> <p> <b>Distribution.</b> Sikkim to Indochina, Hainan, Malay Peninsula, Borneo, Sumatra, Java.</p> <p> <b>Material examined.</b> 1 <i>3</i>, Wuzhishan, Hainan, China, 15.IV.2015, G.X. Xue leg.</p> <p> <b>Male genitalia</b> (Fig. 2). In dorsal view, tegumen slightly tapered; uncus basally constricted and distally expanded, its end deeply bifid into a pair of inwardly curved blunt-pointed horns. Lateral processes reach to half of the horns of uncus, ventral side with a small hook in the middle, distal half thinner and tapered. Gnathos distally tapered and left and right parts separated from each other. Saccus short. Dorsal margin of valva slightly bifid in the middle, basal half flat, without footstalk; distal half densely furnished with strong sawteeth, dorsal margin widely U-shaped, forming a triangular basal branch and a narrower elongated distal branch, of which the distal margin is shallowly indented to form a strong upper branch and a small lower branch. Aedeagus shorter than ventral margin of valva, suprazonal sheath tapered toward fore-end, dorsal margin of subzonal sheath deeply concave. Juxta quadrangular.</p> <p> <b>COI sequence.</b> Genbank Accession MH444659, voucher HaiN-A32, 661 base pairs: ATTCAACCAATCATAAAGATATTGGAACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCT CTAAGATTATTAATTCGTACTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTAT TGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACT AGTTCCCCTAATATTAGGAGCCCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATGTTACCCC CTTCTTTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGTACCGGATGAACAGTTTACCCCC CTCTTTCTTCTAATATTGCTCATCAAGGTTCATCCGTTGATTTAGCTATTTTTTCCTTACATTTAGCAGGTATTT CCTCAATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAAA TACCTTTATTCGTTTGAGCTGTAGGAATTACTGCTTTACTTTTATTACTTTCATTACCAGTTTTAGCTGGAGCT ATTACAATATTATTAACTGATCGAAATTTAAATACtTCTTTTTTTGATCCTGCAGGAGGAGGAGATCC</p> <p> <b>Remarks.</b> Evans (1949) recorded one male <i>Halpe sikkima</i> from Hainan. Since then, no more material of this species has been collected from this place again, although field surveys have been carried out on the island repeatedly, and a number of hesperiid species have been published as new to science (Chou 1994; Fan <i>et al</i>. 2007a; Fan <i>et al</i>. 2007b; Fan & Chiba 2008) or discovered as new records to the skipper fauna of China (Fan <i>et al</i>. 2003; Fei <i>et al</i>. 2015). In recent literature specializing in the fauna of Hainan skippers (e.g. Gu & Chen 1997; Gu 2002; Chiba 2008), this species was not included. Thus, <i>H. sikkima</i> remained a mysterious species in Hainan, and its occurrence on the island needed reconfirmation. During a collecting trip at Wuzhishan (Fig. 3) in 2015, a male <i>H. sikkima</i> was captured by the first author of the present paper, representing the second specimen of this species from the island. Considering the figures and descriptions of the male genitalia in literature which are not complete and precise enough (Evans 1949; Maruyama 1991), illustrations and a re-description are provided in this paper. DNA was extracted from one leg of the dried specimen using DNeasy <i>®</i> Blood and Tissue Kit (Qiagen, Germany). The COI gene was amplified by PCR as described by Hajibabaei <i>et al.</i> (2006) and then sequenced by Sangon biotech, Shanghai, China. The COI sequence is published herein for the potential use in DNA barcoding and a molecular phylogeny study in the future.</p>Published as part of <i>Xue, Guoxi, Lv, Hongkun, Hu, Neng, Yin, Weizhi & Li, Meng, 2018, Rediscovery of an elusive species, Halpe sikkima Moore, 1882 (Hesperiidae, Hesperiinae) from Hainan, China, pp. 85-88 in Zootaxa 4486 (1)</i> on pages 85-86, DOI: 10.11646/zootaxa.4486.1.7, <a href="http://zenodo.org/record/1438057">http://zenodo.org/record/1438057</a&gt

Compact Water-Cooled Thermoelectric Generator (TEG) Based on a Portable Gas Stove

A compact water-cooled thermoelectric generator (TEG) based on a portable gas stove was designed and analyzed to supply electricity in off-grid scenarios. The TEG incorporates a newly designed heat collector, eight thermoelectric (TE) modules, and a radiator to ensure its portability (5.9 kg) and sufficiency of electric power (12.9 W). Detailed measurements and discussions on power load feature and TE efficiency are presented. Experiments showed that the power generation capability of the proposed TEG is compromised by its compactness over previous water-cooled TEGs. A theoretical model incorporated with heat leaks from various origins has been developed to illustrate that the designed TEG exerts the potential of every TE module, and to reveal the proportion of various heat fluxes. The predicted electric power, various heat fluxes, and TE efficiency agree well with experimental data. The limitations of TE efficiency and the nonlinearity caused by Joule heat are discussed quantitatively

Rediscovery of an elusive species, Halpe sikkima Moore, 1882 (Hesperiidae, Hesperiinae) from Hainan, China

Xue, Guoxi, Lv, Hongkun, Hu, Neng, Yin, Weizhi, Li, Meng (2018): Rediscovery of an elusive species, Halpe sikkima Moore, 1882 (Hesperiidae, Hesperiinae) from Hainan, China. Zootaxa 4486 (1): 85-88, DOI: https://doi.org/10.11646/zootaxa.4486.1.

The value of the preoperative Naples prognostic score in predicting prognosis in gallbladder cancer surgery patients

Abstract Purpose The Naples prognostic score (NPS) is a comprehensive prognostic model that includes inflammatory and nutrition-related indicators and is increasingly used as a prognostic score for various malignant tumors. Given its predictive effect on prognosis in patients with gallbladder cancer, it is currently unclear. This study aimed to investigate the role of preoperative NPS in predicting prognosis in gallbladder cancer surgery patients. Patients and methods A retrospective analysis was performed for 135 patients who underwent radical surgery for gallbladder cancer without preoperative treatment between March 2011 and January 2020. NPS was calculated by measuring the preoperative total cholesterol value, serum albumin value, neutrophil–lymphocyte ratio (NLR), and lymphocyte-monocyte ratio (LMR). They were then divided into 3 groups (groups 0, 1, and 2) based on NPS scores. Survival analysis was performed using the Kaplan–Meier method and log-rank test. Univariate and multivariate Cox proportional hazards models were used to identify independent prognostic factors. Plot time-dependent receiver operating characteristic (ROC) curves to compare the prognostic value of scoring systems. Finally, a nomogram model was developed with independent prognostic factors. Results Multivariate analysis showed that NPS was an independent risk factor affecting OS (HR = 3.417, p < 0.05). The time-dependent ROC curve results showed that NPS had a better predictive value on survival prognosis than other indicators. The nomogram constructed according to independent factors such as NPS has a good predictive ability for OS. Conclusion As a simple and reliable tool, the NPS has important predictive value in the survival prognosis of gallbladder cancer patients. The nomogram model constructed by NPS will help determine prognosis and make individualized treatment decisions

Study on the Roles of Water in Solid Amine-Based Direct Air Capture of CO

Climate change triggered by the increasing amount of CO2 released into the atmosphere has become a global priority. Direct Air Capture (DAC) of CO2 has been regarded as one of the disruptive technologies to realize negative emission. Among the multiple strategies employed, adsorption on solid amines is a promising choice owing to its low energy requirements. Since the water vapor ubiquitously exists in ambient air, understanding the role it plays in DAC by the amine-functionalized solid sorbents is of vital importance. Due to the diversity in amine and support features, both promotion and deterioration of water impact on CO2 adsorption were revealed. Herein we present a multifaceted review of the trends and innovations in DAC by solid amines under humid conditions. The effect of water was discussed over four groups of materials, based on the support categories, i.e., (a) mesoporous silica, (b) mesoporous alumina, (c) mesoporous carbon and other inorganic supports, and (d) cellulose and other organic supports

Multi‐stage flexible planning of regional electricity‐HCNG‐integrated energy system considering gas pipeline retrofit and expansion

Abstract The development of hydrogen‐enriched compressed natural gas (HCNG) can make full use of the existing natural gas infrastructure, thereby alleviating the economic and technical pressure on the development of pure hydrogen. This paper proposes a multi‐stage flexible planning method for the regional electricity‐HCNG‐integrated energy system (E‐HCNG‐IES), which considers the medium and long‐term dynamic characteristics of the E‐HCNG‐IES. For each sub‐regional energy station, an energy‐hub type model including hydrogen/HCNG‐related equipment and facilities is established. Considering the influence of hydrogen blending on the energy delivery capacity and line pack of pipelines, a hydrogen‐resistant retrofit model for existing natural gas pipelines between sub‐regions is proposed. Meanwhile, the model for newly constructed hydrogen pipelines is also presented. Subsequently, a series of flexibility evaluation indicators are proposed to support the performance analysis of planning schemes. The lateral comparison of sub‐cases in Changzhou, China demonstrates that considering the hydrogen‐resistant retrofit of natural gas pipelines can reduce the construction cost of hydrogen pipelines by about 37.12%. The peak shaving capacity of underground hydrogen storage (UHS), the energy recycling ability of turbo expander (TE), and the space‐time decoupling ability of hydrogen in energy supply and demand have also been confirmed

Topology optimization method of district heating system considering load uncertainty

With the implementation of the carbon peaking and carbon neutrality strategy, China's heating system has witnessed various transformative trends, including source-network-load integration and the synergistic utilization of fossil and renewable energy sources. The district heating system, serving as a vital intermediary between heat sources and end-users, plays a crucial role in ensuring a stable energy supply. Particularly, as renewable energy integration increases and end-user requirements become more refined, the demand-supply matching aspect of district heating systems becomes increasingly critical. Therefore, it is essential to quantify and analyze user demand while establishing an adaptive pipe network capable of accommodating fluctuations in end-user load. This paper proposes an optimal topology structure method for district heating systems, taking into account the uncertainty of end-user load. Specifically, a quantitative model of end-user load uncertainty is developed, utilizing the Gram-Charlier A expansion method to capture the factors influencing end-user load uncertainty comprehensively. Furthermore, an optimization model for the pipe network topology is formulated, which considers the uncertainty of end-user load as a constraint and aims to minimize pipeline construction costs. This model optimizes the layout, size, and location of heating sources within the district heating system. The proposed method's practical applicability is validated through a case study of a district heating system in a northern Chinese city that involves 21 end-users. The results indicate that the end-user load uncertainty model outperforms the conventional normal distribution fitting model when dealing with bimodal load distributions. Additionally, the proposed method reduces construction costs by 6.24%, decreases heat loss by 5.30%, and eliminates redundant structures within the district heating system. This research significantly contributes to the planning and design of heating pipeline networks and the optimization and refurbishment of existing pipeline networks within district heating systems

Construct a Regional Innovation Ecosystem: A Case Study of the Beijing-Tianjin-Hebei Region in China

Constructing a Regional Innovation Ecosystem (RIE) can be an effective way to utilize innovation resources by breaking the existing regional barriers. Existing research focuses more on exploring the characteristics, evolution, and impact of innovation ecosystems from a theoretical perspective, while few studies combine reality with exploring how to build an effective innovation ecosystem. Given that the concept of an innovation ecosystem is inspired by natural ecosystems, using the method of comparative analysis, this article begins by analyzing the characteristics of tropical rainforests as the most stable and efficient natural ecosystem and deeply explores the essential features of an efficient RIE, including an innovative soft and hard environment, multi-level and differentiated producers, consumers and decomposers of innovative activities, and a virtuous cycle of innovation resources. By comparing Beijing-Tianjin-Hebei’s current reality with these characteristics, this article systematically analyzes the advantages of the innovation environment, the further improvement of innovation resource aggregation and innovation chains, as well as the disadvantages of an unbalanced distribution of innovation resources, the leapfrogging transformation of scientific and technological achievements, low innovation levels of market-oriented innovation entities, and loss of innovative factors, such as talents. Based on this analysis, targeted suggestions to construct a RIE in Beijing-Tianjin-Hebei, including using both market and administrative approaches to allocating innovation factors, stimulating the innovation vitality of market-oriented innovation entities, taking multiple measures to enhance Hebei Province’s capacity, building an innovative environment that is livable and business-friendly are proposed