3,033 research outputs found
High impact activities in parks: best management practice and future research
Off-road driving, horseriding, rock climbing and similar activities can be lucrative for tour operators and important for local recreational groups, but contentious for management of national parks and protected areas, both because of safety and liability and because of potentially high environmental impacts. These include spreading weeds and pathogens, starting fires and crushing bird nests on beaches, amongst many others. In Australia as elsewhere, off-road vehicles and horses are allowed only in some places in some parks, and often only under permit. We have very little reliable scientific information to-date on just how serious these impacts may be, and on how well they might be managed through minimal-impact practices such as vehicle washdowns, stockfeed processing and seasonal closures. Such information can only be obtained through site specific ecological studies of the plants, animals and watercourses likely to be affected, differentiating tourism impacts from natural causes and fluctuations. This report examines management strategies for these activities worldwide and in Australia. Suggestions for best management practice and future research agendas are set
Formal Verification of Nonlinear Inequalities with Taylor Interval Approximations
We present a formal tool for verification of multivariate nonlinear
inequalities. Our verification method is based on interval arithmetic with
Taylor approximations. Our tool is implemented in the HOL Light proof assistant
and it is capable to verify multivariate nonlinear polynomial and
non-polynomial inequalities on rectangular domains. One of the main features of
our work is an efficient implementation of the verification procedure which can
prove non-trivial high-dimensional inequalities in several seconds. We
developed the verification tool as a part of the Flyspeck project (a formal
proof of the Kepler conjecture). The Flyspeck project includes about 1000
nonlinear inequalities. We successfully tested our method on more than 100
Flyspeck inequalities and estimated that the formal verification procedure is
about 3000 times slower than an informal verification method implemented in
C++. We also describe future work and prospective optimizations for our method.Comment: 15 page
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
Submillimetre dust polarisation and opacity in the HD163296 protoplanetary ring system
We present ALMA images of the sub-mm continuum polarisation and spectral
index of the protoplanetary ringed disk HD163296. The polarisation fraction at
870{\mu}m is measured to be ~0.9% in the central core and generally increases
with radius along the disk major axis. It peaks in the gaps between the dust
rings, and the largest value (~4%) is found between rings 1 and 2. The
polarisation vectors are aligned with the disk minor axis in the central core,
but become more azimuthal in the gaps, twisting by up to +/-9degrees in the gap
between rings 1 and 2. These general characteristics are consistent with a
model of self-scattered radiation in the ringed structure, without requiring an
additional dust alignment mechanism. The 870/1300{\mu}m dust spectral index
exhibits minima in the centre and the inner rings, suggesting these regions
have high optical depths. However, further refinement of the dust or the disk
model at higher resolution is needed to reproduce simultaneously the observed
degree of polarisation and the low spectral index.Comment: 5 pages +2 pages supplemental data. v2 - revised figures and final
values; conclusions unchange
Experimental study of the jamming transition at zero temperature
We experimentally investigate jamming in a quasi-two-dimensional granular
system of automatically swelling particles and show that a maximum in the
height of the first peak of the pair correlation function is a structural
signature of the jamming transition at zero temperature. The same signature is
also found in the second peak of the pair correlation function, but not in the
third peak, reflecting the underlying singularity of jamming transition. We
also study the development of clusters in this system. A static length scale
extracted from the cluster structure reaches the size of the system when the
system approaches the jamming point. Finally, we show that in a highly
inhomogeneous system, friction causes the system to jam in series of steps. In
this case, jamming may be obtained through successive buckling of force chains.Comment: 15 pages, 17 figure
When Silence is Not Golden: Why Acknowledgement Matters Even When Being Excluded
Following ostracism, individuals are highly sensitive to social cues. Here we investigate whether and when minimal acknowledgment can improve need satisfaction following an ostracism experience. In four studies, participants were either ostracized during Cyberball (Studies 1 and 2) or through a novel apartment-application paradigm (Studies 3 and 4). To signal acknowledgement following ostracism, participants were either thrown a ball a few times at the end of the Cyberball game, or received a message that was either friendly, neutral, or hostile in the apartment-application paradigm. Both forms of acknowledgment increased need satisfaction, even when the acknowledgment was hostile (Study 4), emphasizing the beneficial effect of any kind of acknowledgment following ostracism. Reinclusion buffered threat immediately, whereas acknowledgment without reinclusion primarily aided recovery. Our results suggest that minimal acknowledgment such as a few ball throws or even an unfriendly message can reduce the sting of ostracism
‘Distancers’ and ‘non-distancers’? The potential social psychological impact of moralizing COVID-19 mitigating practices on sustained behaviour change
COVID‐19 mitigating practices such as ‘hand‐washing’, ‘social distancing’, or ‘social isolating’ are constructed as ‘moral imperatives’, required to avert harm to oneself and others. Adherence to COVID‐19 mitigating practices is presently high among the general public, and stringent lockdown measures supported by legal and policy intervention have facilitated this. In the coming months, however, as rules are being relaxed and individuals become less strict, and thus, the ambiguity in policy increases, the maintenance of recommended social distancing norms will rely on more informal social interactional processes. We argue that the moralization of these practices, twinned with relaxations of policy, may likely cause interactional tension between those individuals who do vs. those who do not uphold social distancing in the coming months: that is, derogation of those who adhere strictly to COVID‐19 mitigating practices and group polarization between ‘distancers’ and ‘non‐distancers’. In this paper, we explore how and why these processes might come to pass, their impact on an overall societal response to COVID‐19, and the need to factor such processes into decisions regarding how to lift restriction
- …