TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM

Prevalence of adult asthma symptoms in relation to climate in New Zealand.

We conducted an ecological study linking prevalence of adult asthma symptoms with climate in the 93 New Zealand general electorates. For each electorate, the 12-month period prevalence of self-reported asthma symptoms was determined using a random sample of adults aged 20-44 on the 1991 New Zealand electoral roll. Long-term average climate was estimated using a national climate database and a geographic information system. Asthma prevalence was calculated within quartiles of the exposure variables. Independent effects of climate variables were assessed using linear regression models, with adjustment for confounding by climate, social deprivation, and geographic variables. There was a statistically significant association between asthma prevalence and mean temperature, with the lowest quartile of mean temperature having an approximately 2% lower asthma prevalence. After adjusting for confounding, there was a monotonic increase in asthma prevalence within quartiles of temperature. The results of this study are in agreement with other research suggesting a lower prevalence of asthma at low temperatures. Although on short (day-to-day) time scales, low temperatures may have a direct effect resulting in acute exacerbations of asthma symptoms, warmer average temperatures are associated with increased asthma prevalence. The reasons for this are unclear, although it is possible that on longer term (annual) time scales, higher temperatures are associated with higher levels of allergen exposure

Functionally Annotating Regulatory Elements in the Equine Genome Using Histone Mark ChIP-Seq.

One of the primary aims of the Functional Annotation of ANimal Genomes (FAANG) initiative is to characterize tissue-specific regulation within animal genomes. To this end, we used chromatin immunoprecipitation followed by sequencing (ChIP-Seq) to map four histone modifications (H3K4me1, H3K4me3, H3K27ac, and H3K27me3) in eight prioritized tissues collected as part of the FAANG equine biobank from two thoroughbred mares. Data were generated according to optimized experimental parameters developed during quality control testing. To ensure that we obtained sufficient ChIP and successful peak-calling, data and peak-calls were assessed using six quality metrics, replicate comparisons, and site-specific evaluations. Tissue specificity was explored by identifying binding motifs within unique active regions, and motifs were further characterized by gene ontology (GO) and protein-protein interaction analyses. The histone marks identified in this study represent some of the first resources for tissue-specific regulation within the equine genome. As such, these publicly available annotation data can be used to advance equine studies investigating health, performance, reproduction, and other traits of economic interest in the horse

The Taurus Boundary of Stellar/Substellar (TBOSS) Survey II. Disk Masses from ALMA Continuum Observations

We report 885$\mu$m ALMA continuum flux densities for 24 Taurus members spanning the stellar/substellar boundary, with spectral types from M4 to M7.75. Of the 24 systems, 22 are detected at levels ranging from 1.0-55.6 mJy. The two non-detections are transition disks, though other transition disks in the sample are detected. Converting ALMA continuum measurements to masses using standard scaling laws and radiative transfer modeling yields dust mass estimates ranging from $\sim$0.3-20M$_{\oplus}$. The dust mass shows a declining trend with central object mass when combined with results from submillimeter surveys of more massive Taurus members. The substellar disks appear as part of a continuous sequence and not a distinct population. Compared to older Upper Sco members with similar masses across the substellar limit, the Taurus disks are brighter and more massive. Both Taurus and Upper Sco populations are consistent with an approximately linear relationship in $M_{dust}$ to $M_{star}$, although derived power-law slopes depend strongly upon choices of stellar evolutionary model and dust temperature relation. The median disk around early M-stars in Taurus contains a comparable amount of mass in small solids as the average amount of heavy elements in Kepler planetary systems on short-period orbits around M-dwarf stars, with an order of magnitude spread in disk dust mass about the median value. Assuming a gas:dust ratio of 100:1, only a small number of low-mass stars and brown dwarfs have a total disk mass amenable to giant planet formation, consistent with the low frequency of giant planets orbiting M-dwarfs.Comment: 41 pages and 32 figures, with all tables and appendices presented here in their entirety. Accepted for publication in AJ (November 26, 2017

Suckling a protein-restricted rat dam leads to diminished albuminuria in her male offspring in adult life: a longitudinal study.

BACKGROUND: Previous studies have shown that in male rats, exposure to maternal protein restriction either in utero or whilst suckling can have profound effects on both longevity and kidney telomere lengths. This study monitored albuminuria longitudinally in male rats whose mothers had been protein restricted either during pregnancy or lactation. METHODS: Pregnant Wistar rats were fed either a 20% ('control') or an 8% protein ('low protein') diet. At two days of age some of the pups were cross-fostered to dams fed the diet that was not given to their biological mothers. At weaning all pups were fed standard chow. Urine samples were collected for the measurement of albumin and creatinine at monthly intervals from two months-of-age. Longitudinal analysis was then performed using repeated measures analysis of variance. RESULTS: Overall estimated marginal geometric mean (95 % confidence interval) urine albumin to creatinine ratios were: control animals 79.5 (57.2 to approximately 110.6) g/mol (n = 6 litters, 24 animals in total), those exposed in utero to maternal protein restriction 71.0 (47.4 to approximately 106.5) (n = 4 litters, 16 animals in total), those exposed to maternal protein restriction whilst suckling 21.2 (14.7 to approximately 30.4) (n = 5 litters, 20 animals in total) (p < 0.001). These latter animals had lower albumin to creatinine ratios than either of the two other groups (both p < 0.001), which had ratios that were indistinguishable from each other (p = 1.0). Similar results were gained using 24 h. urine albumin excretion rates. These differences became evident from three months-of-age and were long-lasting. CONCLUSION: Animals exposed to maternal protein restriction whilst suckling exhibited lower urine albumin excretions during much of adult life. As urine albumin can be nephrotoxic, these rats therefore appeared to be relatively protected against future nephron damage like that previously observed in animals exposed to maternal protein restriction in utero

Certification of Bounds of Non-linear Functions: the Templates Method

The aim of this work is to certify lower bounds for real-valued multivariate functions, defined by semialgebraic or transcendental expressions. The certificate must be, eventually, formally provable in a proof system such as Coq. The application range for such a tool is widespread; for instance Hales' proof of Kepler's conjecture yields thousands of inequalities. We introduce an approximation algorithm, which combines ideas of the max-plus basis method (in optimal control) and of the linear templates method developed by Manna et al. (in static analysis). This algorithm consists in bounding some of the constituents of the function by suprema of quadratic forms with a well chosen curvature. This leads to semialgebraic optimization problems, solved by sum-of-squares relaxations. Templates limit the blow up of these relaxations at the price of coarsening the approximation. We illustrate the efficiency of our framework with various examples from the literature and discuss the interfacing with Coq.Comment: 16 pages, 3 figures, 2 table

Radio Frequency Spectra of 388 Bright 74 MHz Sources

As a service to the community, we have compiled radio frequency spectra from the literature for all sources within the VLA Low Frequency Sky Survey (VLSS) that are brighter than 15 Jy at 74 MHz. Over 160 references were used to maximize the amount of spectral data used in the compilation of the spectra, while also taking care to determine the corrections needed to put the flux densities from all reference on the same absolute flux density scale. With the new VLSS data, we are able to vastly improve upon previous efforts to compile spectra of bright radio sources to frequencies below 100 MHz because (1) the VLSS flux densities are more reliable than those from some previous low frequency surveys and (2) the VLSS covers a much larger area of the sky (declination >-30 deg.) than many other low frequency surveys (e.g., the 8C survey). In this paper, we discuss how the spectra were constructed and how parameters quantifying the shapes of the spectra were derived. Both the spectra and the shape parameters are made available here to assist in the calibration of observations made with current and future low frequency radio facilities.Comment: Accepted to ApJ

The VLA Low-frequency Sky Survey

The Very Large Array (VLA) Low-frequency Sky Survey (VLSS) has imaged 95% of the 3*pi sr of sky north of declination = -30 degrees at a frequency of 74 MHz (4 meter wavelength). The resolution is 80" (FWHM) throughout, and the typical RMS noise level is ~0.1 Jy/beam. The typical point-source detection limit is 0.7 Jy/beam and so far nearly 70,000 sources have been catalogued. This survey used the 74 MHz system added to the VLA in 1998. It required new imaging algorithms to remove the large ionospheric distortions at this very low frequency throughout the entire ~11.9 degree field of view. This paper describes the observation and data reduction methods used for the VLSS and presents the survey images and source catalog. All of the calibrated images and the source catalog are available online (http://lwa.nrl.navy.mil/VLSS) for use by the astronomical community.Comment: 53 pages, including 3 tables and 15 figures. Has been accepted for publication in the Astronomical Journa