Values and beliefs as predictors of pre-service teachers’ enjoyment of teaching in inclusive settings

As several countries have committed themselves to the promotion of inclusive school systems, teachers might feel overwhelmed by the additional competencies needed for inclusive teaching. Beyond an increase in specialised knowledge, these competencies include a coherent belief system to facilitate the adoption of inclusive practices. Currently, there is scarce knowledge concerning the foundation of teachers’ beliefs and values and the possible connections between these personality traits and inclusive practices. Based on the theory of cognitive hierarchy, we investigated the predictive ability of the value of universalism in shaping sentiments, attitudes and concerns about inclusive education (RQ1), as well as their links to the anticipated enjoyment of teaching in inclusive settings as an indicator of enthusiasm for teaching (RQ2). Within a sample of 229 biology pre-service teachers (Mage = 22.9 years, SDage = 3.5 years; 76% female, 68% bachelor) we found universalism to be a direct predictor of sentiments, attitudes and concerns regarding inclusive education. Furthermore, universalism was the strongest predictor of anticipated enjoyment of teaching in inclusive settings, while only sentiments about inclusive education were not predictive for enjoyment. The study illustrates how deeper underlying values like universalism is connected to beliefs about inclusive education and subsequent motivations in the classroom. When teacher educators intend to motivate pre-service teachers to teach in inclusive settings, these variables should be kept in mind, though further study must be done on the generalisability of the results for pre-service teachers of other school subjects. © 2019 The Authors. Journal of Research in Special Educational Needs published by John Wiley & Sons Ltd on behalf of National Association for Special Educational Need

Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.

The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation

Exon Array Analysis using re-defined probe sets results in reliable identification of alternatively spliced genes in non-small cell lung cancer

<p>Abstract</p> <p>Background</p> <p>Treatment of non-small cell lung cancer with novel targeted therapies is a major unmet clinical need. Alternative splicing is a mechanism which generates diverse protein products and is of functional relevance in cancer.</p> <p>Results</p> <p>In this study, a genome-wide analysis of the alteration of splicing patterns between lung cancer and normal lung tissue was performed. We generated an exon array data set derived from matched pairs of lung cancer and normal lung tissue including both the adenocarcinoma and the squamous cell carcinoma subtypes. An enhanced workflow was developed to reliably detect differential splicing in an exon array data set. In total, 330 genes were found to be differentially spliced in non-small cell lung cancer compared to normal lung tissue. Microarray findings were validated with independent laboratory methods for <it>CLSTN1</it>, <it>FN1</it>, <it>KIAA1217</it>, <it>MYO18A</it>, <it>NCOR2</it>, <it>NUMB</it>, <it>SLK</it>, <it>SYNE2</it>, <it>TPM1</it>, (in total, 10 events) and <it>ADD3</it>, which was analysed in depth. We achieved a high validation rate of 69%. Evidence was found that the activity of FOX2, the splicing factor shown to cause cancer-specific splicing patterns in breast and ovarian cancer, is not altered at the transcript level in several cancer types including lung cancer.</p> <p>Conclusions</p> <p>This study demonstrates how alternatively spliced genes can reliably be identified in a cancer data set. Our findings underline that key processes of cancer progression in NSCLC are affected by alternative splicing, which can be exploited in the search for novel targeted therapies.</p

Mapping of the range of operational conditions for Cu-, Fe-, and Ni-based oxygen carriers in chemical-looping combustion

Available online September 14, 2006.- El pdf del artículo es la versión post-printChemical-looping combustion (CLC) is a two-step combustion process that produces a pure CO2 stream, ready for compression and sequestration. A CLC system is composed by two reactors, an air and a fuel reactor, and an oxygen carrier (OC) circulating between the reactors, which transfers the oxygen necessary for the fuel combustion from the air to the fuel. This system can be designed similar to a circulating fluidised bed, but with the addition of a bubbling fluidised bed on the return side. A mapping of the range of operational conditions, design values, and OC characteristics is presented for the most usual metal oxides (CuO, Fe2O3, and NiO) and different fuel gases (CH4, H2, and CO). The pressure operation of a CLC system is also considered. Moreover, a comparison of the possible use of three high reactive OCs (Cu10Al-I, Fe45Al-FG, Ni40Al-FG) previously characterised is carried out. It was found that the circulation rates and the solids inventories are linked, and the possible operating conditions are closely dependent on the reactivity of the OCs. The operational limits of the solids circulation rates, given by the mass and heat balances in the system, were defined for the different type of OCs. Moreover, a plot to calculate the solids inventories in a CLC system, valid for any type of OC and fuel gas, is proposed. The minimum solids inventories depended on the fuel gas used, and followed the order CH4 > CO > H2. Values of minimum solids inventories in a range from 40 to 133 kg / MWf were found for the OCs used in this work, excepting for the reaction of Fe45Al-FG with CH4, which needs a higher amount of solids because of its low reactivity. From the economic analysis carried out it was found the cost of the OC particles does not represent any limitation to the development of the CLC technology. © 2006 Elsevier Ltd. All rights reserved.This work was carried out with financial support from the European Coal and Steel Community (Project 7220-PR/125), and the Spanish Ministry of Education and Science (Project CTQ2004- 04034).Peer Reviewe

Kinetic and morphological differentiation of Ettringites in plain and blended Portland cements using Metakaolin and the ASTM C 452-68 test. Part I: kinetic differentiation.

22 pages, 3 figures, 5 tables.[ES] En esta Parte I de la investigación, se han logrado verifi- car mediante el ensayo ASTM C 452-68, los resultados obtenidos en anteriores investigaciones realizadas con DRX y SEM y el ensayo Le Chatelier-Ansttet. Para ello, a 10 cementos Portland –6 CPO y 4 CPRS– se les añadió 20%, 30% y 40% de metakaolín (MK). Tanto los 10 CP como los 30 de sus mezclas con metakaolín (MK), se ensayaron durante 2 años, mediante dicho método ASTM C 452-68, y a sus probetas no sólo se les determinó su incremento porcentual de longitud, ∆L(%), sino además, el contenido de sulfatos de sus aguas de conservación. Otras determinaciones complementarias fueron: análisis químico de los materiales cementiceos utilizados y pro- piedades específicas de algunos cementos ensayados. Los resultados experimentales, ∆L(%) frente al tiempo, han confirmado de nuevo que la velocidad de formación de la ettringita de origen alúmina reactiva, Al2O3 r-, de las puzolanas, tiene que ser considerablemente mayor que la velocidad de formación de la ettringita de origen C3A de los CP, lo que ha sido verificado por la evolución durante todo el ensayo, del contenido de sulfatos de las aguas de conservación de las probetas. Debido a ello, se ha pro- puesto denominar a ambos tipos de ettringitas, ettringita de rápida formación, ett-rf, y ettringita de lenta forma- ción, ett-lf, respectivamente.[EN] In this first part of the study, the results obtained in prior research with XRD and SEM, as well as the Le Chatelier- Ansttet test were confirmed with the ASTM C 452-68 test. To this end, 20%, 30% and 40% metakaolin (MK) was added to ten Portland cements, six OPCs and four SRPCs. Both the ten plain PCs and the 30 metakaolin (MK) blends were tested for two years under ASTM C 452-68 specifications, determining not only the percentage increase in length, ΔL(%), of the specimens, but also the sulphate content in the curing water. Other parameters studied included: chemical analysis of the cementitious materials used and specific properties of some of the cements tested. The experimental results, ΔL(%) versus time, re-confirmed that the formation rate of ettringite from the reactive alumina, Al2O3 r-, present in the pozzolan must be substantially higher than the formation rate of ettringite from the C3A present in the PC. This was verified by the variation of the sulphate content in the specimen curing water throughout the test. In light of those findings, in this article these two types of ettringite are denominated rapid forming ettringite or ett-rf, and slow forming ettringite or ett-lf.Peer reviewe

AKT1 (E17K) mutation profiling in breast cancer: prevalence, concurrent oncogenic alterations, and blood-based detection.

BACKGROUND: The single hotspot mutation AKT1 [G49A:E17K] has been described in several cancers, with the highest incidence observed in breast cancer. However, its precise role in disease etiology remains unknown. METHODS: We analyzed more than 600 breast cancer tumor samples and circulating tumor DNA for AKT1 (E17K) and alterations in other cancer-associated genes using Beads, Emulsions, Amplification, and Magnetics digital polymerase chain reaction technology and targeted exome sequencing. RESULTS: Overall AKT1 (E17K) mutation prevalence was 6.3 % and not correlated with age or menopausal stage. AKT1 (E17K) mutation frequency tended to be lower in patients with grade 3 disease (1.9 %) compared with those with grade 1 (11.1 %) or grade 2 (6 %) disease. In two cohorts of patients with advanced metastatic disease, 98.0 % (n = 50) and 97.1 % (n = 35) concordance was obtained between tissue and blood samples for the AKT1 (E17K) mutation, and mutation capture rates of 66.7 % (2/3) and 85.7 % (6/7) in blood versus tissue samples were observed. Although AKT1-mutant tumor specimens were often found to harbor concurrent alterations in other driver genes, a subset of specimens harboring AKT1 (E17K) as the only known driver alteration was also identified. Initial follow-up survival data suggest that AKT1 (E17K) could be associated with increased mortality. These findings warrant additional long-term follow-up. CONCLUSIONS: The data suggest that AKT1 (E17K) is the most likely disease driver in certain breast cancer patients. Blood-based mutation detection is achievable in advanced-stage disease. These findings underpin the need for a further enhanced-precision medicine paradigm in the treatment of breast cancer

ESTRUTURA DA ASSEMBLEIA DE FORMIGAS (HYMENOPTERA: FORMICIDAE) EPIGÉICAS EM ÁREAS REABILITADAS APÓS MINERAÇÃO DE CARVÃO A CÉU ABERTO NO SUL DE SANTA CATARINA, BRASIL

A mineração de carvão representa uma das atividades que causa elevada degradação ambiental, com grande destaque para a região sul de Santa Catarina. O processo de reabilitação das áreas mineradas passa por uma série de procedimentos, visando à restauração das condições mínimas necessárias para o reestabelecimento da biodiversidade. Pesquisas que avaliem este processo são fundamentais para o monitoramento do grau de reestruturação destas áreas

ESTRUTURA DA ASSEMBLEIA DE FORMIGAS (HYMENOPTERA: FORMICIDAE) EPIGÉICAS EM ÁREAS REABILITADAS APÓS MINERAÇÃO DE CARVÃO A CÉU ABERTO NO SUL DE SANTA CATARINA, BRASIL

A mineração de carvão representa uma das atividades que causa elevada degradação ambiental, com grande destaque para a região sul de Santa Catarina. O processo de reabilitação das áreas mineradas passa por uma série de procedimentos, visando à restauração das condições mínimas necessárias para o reestabelecimento da biodiversidade. Pesquisas que avaliem este processo são fundamentais para o monitoramento do grau de reestruturação destas áreas