119 research outputs found
Ten years of the horse reference genome: insights into equine biology, domestication and population dynamics in the post-genome era.
The horse reference genome from the Thoroughbred mare Twilight has been available for a decade and, together with advances in genomics technologies, has led to unparalleled developments in equine genomics. At the core of this progress is the continuing improvement of the quality, contiguity and completeness of the reference genome, and its functional annotation. Recent achievements include the release of the next version of the reference genome (EquCab3.0) and generation of a reference sequence for the Y chromosome. Horse satellite-free centromeres provide unique models for mammalian centromere research. Despite extremely low genetic diversity of the Y chromosome, it has been possible to trace patrilines of breeds and pedigrees and show that Y variation was lost in the past approximately 2300Â years owing to selective breeding. The high-quality reference genome has led to the development of three different SNP arrays and WGSs of almost 2000 modern individual horses. The collection of WGS of hundreds of ancient horses is unique and not available for any other domestic species. These tools and resources have led to global population studies dissecting the natural history of the species and genetic makeup and ancestry of modern breeds. Most importantly, the available tools and resources, together with the discovery of functional elements, are dissecting molecular causes of a growing number of Mendelian and complex traits. The improved understanding of molecular underpinnings of various traits continues to benefit the health and performance of the horse whereas also serving as a model for complex disease across species
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
Recommended from our members
Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM
Recommended from our members
Functionally Annotating Regulatory Elements in the Equine Genome Using Histone Mark ChIP-Seq.
One of the primary aims of the Functional Annotation of ANimal Genomes (FAANG) initiative is to characterize tissue-specific regulation within animal genomes. To this end, we used chromatin immunoprecipitation followed by sequencing (ChIP-Seq) to map four histone modifications (H3K4me1, H3K4me3, H3K27ac, and H3K27me3) in eight prioritized tissues collected as part of the FAANG equine biobank from two thoroughbred mares. Data were generated according to optimized experimental parameters developed during quality control testing. To ensure that we obtained sufficient ChIP and successful peak-calling, data and peak-calls were assessed using six quality metrics, replicate comparisons, and site-specific evaluations. Tissue specificity was explored by identifying binding motifs within unique active regions, and motifs were further characterized by gene ontology (GO) and protein-protein interaction analyses. The histone marks identified in this study represent some of the first resources for tissue-specific regulation within the equine genome. As such, these publicly available annotation data can be used to advance equine studies investigating health, performance, reproduction, and other traits of economic interest in the horse
Decoding the Equine Genome: Lessons from ENCODE
The horse reference genome assemblies, EquCab2.0 and EquCab3.0, have enabled great advancements in the equine genomics field, from tools to novel discoveries. However, significant gaps of knowledge regarding genome function remain, hindering the study of complex traits in horses. In an effort to address these gaps and with inspiration from the Encyclopedia of DNA Elements (ENCODE) project, the equine Functional Annotation of Animal Genome (FAANG) initiative was proposed to bridge the gap between genome and gene expression, providing further insights into functional regulation within the horse genome. Three years after launching the initiative, the equine FAANG group has generated data from more than 400 experiments using over 50 tissues, targeting a variety of regulatory features of the equine genome. In this review, we examine how valuable lessons learned from the ENCODE project informed our decisions in the equine FAANG project. We report the current state of the equine FAANG project and discuss how FAANG can serve as a template for future expansion of functional annotation in the equine genome and be used as a reference for studies of complex traits in horse. A well-annotated reference functional atlas will also help advance equine genetics in the pan-genome and precision medicine era
"Adopt-a-Tissue" Initiative Advances Efforts to Identify Tissue-Specific Histone Marks in the Mare
Generation of an equine biobank to be used for Functional Annotation of Animal Genomes project
The Functional Annotation of Animal Genomes (FAANG) project aims to identify genomic regulatory elements in both sexes across multiple stages of development in domesticated animals. This study represents the first stage of the FAANG project for the horse, Equus caballus. A biobank of 80 tissue samples, two cell lines and six body fluids was created from two adult Thoroughbred mares. Ante-mortem assessments included full physical examinations, lameness, ophthalmologic and neurologic evaluations. Complete blood counts and serum biochemistries were also performed. At necropsy, in addition to tissue samples, aliquots of serum, ethylenediaminetetraacetic acid (EDTA) plasma, heparinized plasma, cerebrospinal fluid, synovial fluid, urine and microbiome samples from all regions of the gastrointestinal and urogenital tracts were collected. Epidermal keratinocytes and dermal fibroblasts were cultured from skin samples. All tissues were grossly and histologically evaluated by a board-certified veterinary pathologist. The results of the clinical and pathological evaluations identified subclinical eosinophilic and lymphocytic infiltration throughout the length of the gastrointestinal tract as well as a mild clinical lameness in both animals. Each sample was cryo-preserved in multiple ways, and nuclei were extracted from selected tissues. These samples represent the first published systemically healthy equine-specific biobank with extensive clinical phenotyping ante- and post-mortem. The tissues in the biobank are intended for community-wide use in the functional annotation of the equine genome. The use of the biobank will improve the quality of the reference annotation and allow all equine researchers to elucidate unknown genomic and epigenomic causes of disease
Long-read RNA Sequencing Improves the Annotation of the Equine Transcriptome
A high-quality reference genome assembly, a biobank of diverse equine tissues from the Functional Annotation of the Animal Genome (FAANG) initiative, and incorporation of long-read sequencing technologies, have enabled efforts to build a comprehensive and tissue-specific equine transcriptome. The equine FAANG transcriptome reported here provides up to 45% improvement in transcriptome completeness across tissue types when compared to either RefSeq or Ensembl transcriptomes. This transcriptome also provides major improvements in the identification of alternatively spliced isoforms, novel noncoding genes, and 3’ transcription termination site (TTS) annotations. The equine FAANG transcriptome will empower future functional studies of important equine traits while providing future opportunities to identify allele-specific expression and differentially expressed genes across tissues
Improved reference genome for the domestic horse increases assembly contiguity and composition
Recent advances in genomic sequencing technology and computational assembly methods have allowed scientists to improve reference genome assemblies in terms of contiguity and composition. EquCab2, a reference genome for the domestic horse, was released in 2007. Although of equal or better quality compared to other first-generation Sanger assemblies, it had many of the shortcomings common to them. In 2014, the equine genomics research community began a project to improve the reference sequence for the horse, building upon the solid foundation of EquCab2 and incorporating new short-read data, long-read data, and proximity ligation data. Here, we present EquCab3. The count of non-N bases in the incorporated chromosomes is improved from 2.33 Gb in EquCab2 to 2.41 Gb in EquCab3. Contiguity has also been improved nearly 40-fold with a contig N50 of 4.5 Mb and scaffold contiguity enhanced to where all but one of the 32 chromosomes is comprised of a single scaffold
- …