Application of ESI FT-ICR MS to Study Kraft Lignin Modification by the Exoenzymes of the White Rot Basidiomycete Fungus TrametesHirsutaLE-BIN 072

Trameteshirsuta is a wood rotting fungus that possesses a vast array of lignin degrading enzymes, including7 laccases, 7 ligninolyticmanganese peroxidases, 9 lignin peroxidases and 2 versatile peroxidases. In this study,electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry (ESI FT-ICR MS)was used to examine kraft lignin modification by the enzymatic system of this fungus.The observed pattern of lignin modification suggested that before the 6th day of cultivation,the fungal enzymatic system tended to degrade more oxidized moleculesand, hence, less recalcitrant molecules, with the production of hard-to-modify reduced molecular species. At some point after the 6th day of cultivation,the fungal enzymatic system tended to degrade more oxidized moleculesand, hence, less recalcitrant molecules, with the production of hard-to-modify reduced molecular species. At some point after the 6th day of cultivation,the fungus started to degrade less oxidized, more recalcitrant, compounds, converting them into the more oxidized forms. The altered pattern of lignin modification enabled changes in the fungal enzymatic system. These changes were further attributed to the appearance of the particular ligninolyticmanganese peroxides enzyme(MnP7), which was added by the fungus to the mixture of enzymes that had already been secreted (VP2 and MnP5). Keywords: wood rotting fungi, kraft lignin, mass spectrometry, peroxidase

Lys98 Substitution in Human AP Endonuclease 1 Affects the Kinetic Mechanism of Enzyme Action in Base Excision and Nucleotide Incision Repair Pathways

Human apurinic/apyrimidinic endonuclease 1 (APE1) is a key enzyme in the base excision repair (BER) and nucleotide incision repair (NIR) pathways. We recently analyzed the conformational dynamics and kinetic mechanism of wild-type (wt) protein, in a stopped-flow fluorescence study. In this study, we investigated the mutant enzyme APE1K98A using the same approach. Lys98 was known to hydrogen bond to the carboxyl group of Asp70, a residue implicated in binding the divalent metal ion. Our data suggested that the conformational selection and induced fit occur during the enzyme action. We expanded upon the evidence that APE1 can pre-exist in two conformations. The isomerization of an enzyme-product complex in the BER process and the additional isomerization stage of enzyme-substrate complex in the NIR process were established for APE1K98A. These stages had not been registered for the wtAPE1. We found that the K98A substitution resulted in a 12-fold reduction of catalytic constant of 5′-phosphodiester bond hydrolysis in (3-hydroxytetrahydrofuran-2-yl)methyl phosphate (F, tetrahydrofuran) containing substrate, and in 200-fold reduction in 5,6-dihydrouridine (DHU) containing substrate. Thus, the K98A substitution influenced NIR more than BER. We demonstrated that the K98A mutation influenced the formation of primary unspecific enzyme-substrate complex in a complicated manner, depending on the Mg2+ concentration and pH. This mutation obstructed the induced fit of enzyme in the complex with undamaged DNA and F-containing DNA and appreciably decreased the stability of primary complex upon interaction of enzyme with DNA, containing the natural apurinic/apyrimidinic (AP) site. Furthermore, it significantly delayed the activation of the less active form of enzyme during NIR and slowed down the conformational conversion of the complex of enzyme with the cleavage product of DHU-substrate. Our data revealed that APE1 uses the same active site to catalyze the cleavage of DHU- and AP-substrates

Probiotic Potential and Functional Properties of Lactobacillus Reuteri, Lactobacillus Rhamnosus and Lactobacillus Helveticus: A Comparative Study

This study was conducted to evaluate and comparethe probiotic propertiesofLactobacillus helveticusNK1, Lactobacillus rhamnosusF and Lactobacillus reuteriLR1lactobacilli strains.Changes in pH, cell growth, proteolytic activity, antioxidantactivity, and angiotensin-converting enzyme(ACE)inhibitoryactivity were monitored during fermentation ofreconstituted skim milk (RSM) by pure cultures of lactobacilli.Among the tested strains, L. helveticusNK1 showed the highest proteolytic, ACE inhibitoryand antioxidantactivitiesduring milk fermentation,followed by L. rhamnosus F and L. reuteriLR1.The promising capability of all of the lactobacilli strains to release bioactivepeptides from the milk proteins was demonstrated. Keywords: Lactobacillus, probiotic, milk fermentation, bioactive peptide

Genetic and Biochemical Characterization of Human AP Endonuclease 1 Mutants Deficient in Nucleotide Incision Repair Activity

Background: Human apurinic/apyrimidinic endonuclease 1 (APE1) is a key DNA repair enzyme involved in both base excision repair (BER) and nucleotide incision repair (NIR) pathways. In the BER pathway, APE1 cleaves DNA at AP sites and 39-blocking moieties generated by DNA glycosylases. In the NIR pathway, APE1 incises DNA 59 to a number of oxidatively damaged bases. At present, physiological relevance of the NIR pathway is fairly well established in E. coli, but has yet to be elucidated in human cells. Methodology/Principal Finding: We identified amino acid residues in the APE1 protein that affect its function in either the BER or NIR pathway. Biochemical characterization of APE1 carrying single K98A, R185A, D308A and double K98A/R185A amino acid substitutions revealed that all mutants exhibited greatly reduced NIR and 39R59 exonuclease activities, but were capable of performing BER functions to some extent. Expression of the APE1 mutants deficient in the NIR and exonuclease activities reduced the sensitivity of AP endonuclease-deficient E. coli xth nfo strain to an alkylating agent, methylmethanesulfonate, suggesting that our APE1 mutants are able to repair AP sites. Finally, the human NIR pathway was fully reconstituted in vitro using the purified APE1, human flap endonuclease 1, DNA polymerase b and DNA ligase I proteins, thus establishing the minimal set of proteins required for a functional NIR pathway in human cells. Conclusion/Significance: Taken together, these data further substantiate the role of NIR as a distinct and separable functio

Kinetics of substrate recognition and cleavage by human 8-oxoguanine-DNA glycosylase

Human 8-oxoguanine-DNA glycosylase (hOgg1) excises 8-oxo-7,8-dihydroguanine (8-oxoG) from damaged DNA. We report a pre-steady-state kinetic analysis of hOgg1 mechanism using stopped-flow and enzyme fluorescence monitoring. The kinetic scheme for hOgg1 processing an 8-oxoG:C-containing substrate was found to include at least three fast equilibrium steps followed by two slow, irreversible steps and another equilibrium step. The second irreversible step was rate-limiting overall. By comparing data from Ogg1 intrinsic fluorescence traces and from accumulation of products of different types, the irreversible steps were attributed to two main chemical steps of the Ogg1-catalyzed reaction: cleavage of the N-glycosidic bond of the damaged nucleotide and β-elimination of its 3′-phosphate. The fast equilibrium steps were attributed to enzyme conformational changes during the recognition of 8-oxoG, and the final equilibrium, to binding of the reaction product by the enzyme. hOgg1 interacted with a substrate containing an aldehydic AP site very slowly, but the addition of 8-bromoguanine (8-BrG) greatly accelerated the reaction, which was best described by two initial equilibrium steps followed by one irreversible chemical step and a final product release equilibrium step. The irreversible step may correspond to β-elimination since it is the very step facilitated by 8-BrG

In situ synthesis, structural chemistry and vibrational spectroscopy of Zn-doped Ca5Mg4(VO4)6

The phase formation of the solid solution Ca5Mg4–xZnx(VO4)6 (0≤x≤4) was studied in situ using differential scanning calorimetry and high-temperature X-Ray powder diffraction (XRPD). XRPD analysis shows the appearance of unavoidable secondary pyrovanadate phases using conventional synthesis methods. The local structure of the solid solution was verified by vibrational spectroscopy. The analysis of the infrared and Raman spectroscopy data allows establishing the main features between vanadate garnets and their isostructural analogs among natural silicates

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer

Love as a Fictitious Commodity: Gift-for-Sex Barters as Contractual Carriers of Intimacy

Abstract Gift-for-sex (GFS) barters are a niche practice potentially representing the commodification of everyday dating practices. We inquire how GFS exchanges are practiced and understood in contemporary Russia. Second, we situate these in relation to contemporary economic culture. Our project provides answers in two steps based on online content. First, we identify GFS exchange practices within a major dating website. Next, we take the signals exchanged in those dating profiles and display their intersubjective meanings in Russia based on blogs and discussion fora. Our analysis focuses on gender roles and inter-gender conflicts, the use of economic jargon, the link between luxury consumption and sexuality, and understandings of gift-giving and generosity, in order to show how GFS barters, despite being contractual, carry emotional and romantic content. As such, love is under a constant conversion process, through the medium of the contractual gift, into the fictitious commodity form