Is in vitro micrografting a possible valid alternative to traditional micropropagation in Cactaceae? Pelecyphora aselliformis as a case study

Several taxa of Cactaceae are endangered by overcollection for commercial purposes, and most of the family is included in the Convention on International Trade in Endangered Species of Fauna and Flora (CITES). Micropropagation may play a key role to keep the pressure off wild populations and contribute to ex situ conservation of endangered taxa. One of the limits of micropropagation is the species-specific requirement of plant regulators for each taxon and sometimes even for different genotypes. With the micrografting technique the rootstock directly provides the scion with the necessary hormonal requirements. In this paper we present data on in vitro grafting of Pelecyphora aselliformis Ehrenberg, an Appendix I CITES listed species critically endangered and sought after by the horticultural trade, on micropropagated Opuntia ficus-indica Miller. Apical and sub-apical scions of P. aselliformis were used to perform micrografting with a successful rate of 97 and 81 % respectively. Survival rate after ex vivo transfer was 85 %. We hypothesize that this method could be applied to other endangered, slow growing taxa of Cactaceae thus contributing to the conservation of this endangered family.Several taxa of Cactaceae are endangered by overcollection for commercial purposes, and most of the family is included in the Convention on International Trade in Endangered Species of Fauna and Flora (CITES). Micropropagation may play a key role to keep the pressure off wild populations and contribute to ex situ conservation of endangered taxa. One of the limits of micropropagation is the species-specific requirement of plant regulators for each taxon and sometimes even for different genotypes. With the micrografting technique the rootstock directly provides the scion with the necessary hormonal requirements. In this paper we present data on in vitro grafting of Pelecyphora aselliformis Ehrenberg, an Appendix I CITES listed species critically endangered and sought after by the horticultural trade, on micropropagated Opuntia ficus-indica Miller. Apical and sub-apical scions of P. aselliformis were used to perform micrografting with a successful rate of 97 and 81 % respectively. Survival rate after ex vivo transfer was 85 %. We hypothesize that this method could be applied to other endangered, slow growing taxa of Cactaceae thus contributing to the conservation of this endangered family

Long-Term Field Evaluation of Conventional vs. Micropropagated Plants of Chrysanthemum cinerariifolium

Pyrethrum is a perennial herbaceous plant endemic to the eastern coast of the Adriatic Sea, and introduced in large areas of nearly all continents, where it is cultivated for the industrial extraction of pyrethrins. Pyrethrins are a group of six closely related monoterpene esters, widely used as natural insecticides. The world production of natural pyrethrins is lower than the market demand, and a wider introduction of this crop within the Mediterranean agrosystems could be an appealing opportunity for farmers and manufacturers. The availability of adequate amounts of selected plant material to bring into cultivation is, however, one of the major issues. Therefore, the in vitro propagation of elite pyrethrum genotypes could be a suitable alternative to conventional propagation methods. In this paper, we present the results of a 9-year field comparison between pyrethrum plants coming from an in vitro propagation protocol and plants obtained by cutting from the same mother plants. Furthermore, since plantlets derived from in vitro regeneration may experience ploidy changes, we evaluated the stability of the ploidy level of pyrethrum micropropagated plants by flow cytometry (FCM) analysis. FCM screening revealed no differences among the morphotypes and between them and the mother plant. Likewise, the field evaluation of plants gave no significant differences between flower yields in both groups. Hence, micropropagation was confirmed as an easy, efficient and reproducible method to obtain large quantities of selected pyrethrum genotypes

Increased Zygote-Derived Plantlet Formation through In Vitro Rescue of Immature Embryos of Highly Apomictic Opuntia ficus-indica (Cactaceae)

O. ficus-indica (prickly pear cactus) is an important forage and food source in arid and semiarid ecosystems and is the most important cactus species in cultivation globally. The high degree of apomixis in the species is a hindrance in plant breeding programs where genetic segregation is sought for the selection of superior genotypes. To understand if in ovulo embryo rescue could increase the proportion of zygotic seedlings, we compared the mature seed-derived seedlings with those regenerated from in vitro embryo rescue at 20, 25, 30, 35, and 40 post-anthesis days (PADs) in four Italian cultivars. The seedlings were classified as apomictic or zygotic based on molecular marker analysis using inter-sequence single repeat (ISSR) primers. Multiple embryos were recovered from all the cultured immature ovules, and plantlets were regenerated and acclimatized to the field post hardening, with success rates ranging from 62% (‘Senza spine’) to 83% (‘Gialla’). The level of polyembryony differed among cultivars and recovery dates, with the highest being ‘Rossa’, producing 4.8 embryos/ovule at 35 PADs, and ‘Gialla’, the lowest, with 2.7 at 40 PADs. The maximum number of embryos observed within a single ovule was 14 in ‘Trunzara bianca’. ISSR analysis revealed that ovule culture at 35 PADs produced the highest percentage of zygotic seedlings in all the cultivars, from 51% (‘Rossa’) to 98% (‘Gialla’), with a high genotype effect as well. Mature seeds produced much fewer seedlings per seed, ranging from 1.2 in ‘Trunzara bianca’ to 2.0 in ‘Rossa’ and a lower percentage of zygotic seedlings (from 14% in ‘Rossa’ to 63% in ‘Gialla’). Our research opens a pathway to increase the availability of zygotic seedlings in O. ficus-indica breeding programs through in ovulo embryo culture

First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia

Molecular cloning and characterization of a phytochelatin synthase gene, PvPCS1, from Pteris vittata L.

Pteris vittata L. is a staggeringly efficient arsenic hyperaccumulator that has been shown to be capable of accumulating up to 23,000 microg arsenic g(-1), and thus represents a species that may fully exploit the adaptive potential of plants to toxic metals. However, the molecular mechanisms of adaptation to toxic metal tolerance and hyperaccumulation remain unknown, and P. vittata genes related to metal detoxification have not yet been identified. Here, we report the isolation of a full-length cDNA sequence encoding a phytochelatin synthase (PCS) from P. vittata. The cDNA, designated PvPCS1, predicts a protein of 512 amino acids with a molecular weight of 56.9 kDa. Homology analysis of the PvPCS1 nucleotide sequence revealed that it has low identity with most known plant PCS genes except AyPCS1, and the homology is largely confined to two highly conserved regions near the 5'-end, where the similarity is as high as 85-95%. The amino acid sequence of PvPCS1 contains two Cys-Cys motifs and 12 single Cys, only 4 of which (Cys-56, Cys-90/91, and Cys-109) in the N-terminal half of the protein are conserved in other known PCS polypeptides. When expressed in Saccharomyces cerevisae, PvPCS1 mediated increased Cd tolerance. Cloning of the PCS gene from an arsenic hyperaccumulator may provide information that will help further our understanding of the genetic basis underlying toxic metal tolerance and hyperaccumulation

Metabolic Profiling and Post-harvest Behavior of “Dottato” Fig (Ficus carica L.) Fruit Covered With an Edible Coating From O. ficus-indica

Fig fruits are usually highly sensitive to some physiopathological disorders during post-harvest life, such as softening and skin cracking. Indeed, the use of edible coating (EC) has been evaluated in several fruit crops to reduce fruit post-harvest transpiration and to maintain fruit visual quality. The aim of this study was to determine the post-harvest metabolic response of breba figs treated with mucilage extract from O puntia ficus-indica cladodes, using an untargeted metabolomic approach. Coated and non-coated (control) fruit were sealed in plastic bags, and stored at 4°C for 7 days. The effect of the ECs on their quality fruit during cold storage and qualitative attributes were evaluated by analyzing the fruit primary metabolism and other qualitative parameters such as total soluble solids (TSS) content, titratable acidity (TA), fresh weight loss and firmness. Results underlined that EC was effective in maintaining fruit fresh weight, and fruit firmness. Stepwise discriminant analysis was able to discriminate fruit conditions. Alanine, xylulose, aspartic acid, glutamic, acid and 2,5-dihydroxypyrazine showed a significant role on discriminating edible coated fruit from untreated ones. Principal component analysis (PCA) was able to highlight clear differences in the overall metabolism changes between untreated and treated fruit. The application of EC significantly mitigated the decrease of most of the aminoacid content during cold storage. EC treatment caused the changes of several organic acids in comparison to untreated control, increasing the amount of carbohydrates and other key metabolites, such as beta-sitosterol, glycerol, and uracil. These results clearly showed the drastic effects of EC on fig metabolism during post-harvest and shed light on the beneficial mechanisms of this treatment

Prevalence and genetic diversity of Grapevine virus A in Tunisia

Prevalence and genetic diversity of the complete CP gene of Grapevine virus A (GVA) were assessed in isolates from rootstocks, wine and table grape varieties and autochthonous grapevines. Wine grapes were the most infected (63%), followed by table grapes (49%) and rootstocks (44%). Autochthonous grapevines were the less infected (35%). Analyses of the complete coat protein sequences of 20 GVA isolates from the main grapevine growing areas of Tunisia identified three phylogroups, accounting, respectively, for 70% (group I), 25% (group IV) and 5% (group III) of the isolates. No sequences clustered into group II. Phylogenetic analyses indicated that Tunisian GVA isolates are not grouped by the host cultivar or geographic origin

Overcoming sexual sterility in conservation of endangered species: the prominent role of biotechnology in the multiplication of Zelkova sicula (Ulmaceae), a relict tree at the brink of extinction

Biotechnology provides valuable tools to support conservation of plant species, especially in case of threatened taxa or when dealing with seed unavailability, low viability or sterility. However, plant cell culture methods have often to face problems associated with tissue recalcitrance to in vitro systems. Recalcitrance can be related to a variety of triggering factors, involving many efforts and manipulations within one or more of the micropropagation stages before obtaining successful results. An in vitro propagation protocol was developed for Zelkova sicula, a very rare and endangered relict tree, endemic to Sicily (Southern Italy). The species revealed extremely recalcitrant to in vitro culture approaches, but after many trials throughout a number of years an effective micropropagation protocol was completed. The rooting rate was about 84% of the treated explants, 8% of which were successfully acclimatized outdoor and reintroduced in the wild within a comprehensive conservation project. The technique allowed to overcome the problems of sexual sterility of this species, hence contributing concretely to contrast the problems connected with its conservation. However, additional efforts need to be carried out in order to refine the acclimatization step and further improve the whole process effectiveness

High-throughput 18K SNP array to assess genetic variability of the main grapevine cultivars from Sicily

The viticulture of Sicily, for its vocation, is one of the most important and ancient forms in Italy. Autochthonous grapevine cultivars, many of which known throughout the world, have always been cultivated in the island from many centuries. With the aim to preserve this large grapevine diversity, previous studies have already started to assess the genetic variability among the Sicilian cultivars by using morphological and microsatellite markers. In this study, simple sequence repeat (SSR) were utilized to verify the true-to-typeness of a large clone collection (101) belonging to 21 biotypes of the most 10 cultivated Sicilian cultivars. Afterwards, 42 Organization Internationale de la Vigne et du Vin (OIV) descriptors and a high-throughput single nucleotide polymorphism (SNP) genotyping array (Vitis18kSNP) were applied to assess genetic variability among cultivars and biotypes of the same cultivar. Ampelographic traits and high-throughput SNP genotyping platforms provided an accuracy estimation of genetic diversity in the Sicilian germplasm, showing the relationships among cultivars by cluster and multivariate analyses. The large SNP panel defined sub-clusters unable to discern among biotypes, previously classified by ampelographic analysis, belonging to each cultivar. These results suggested that a very large number of SNP did not cover the genome regions harboring few morphological traits. Genetic structure of the collection revealed a clear optimum number of groups for K = 3, clustering in the same group a significant portion of family-related genotypes. Parentage analysis highlighted significant relationships among Sicilian grape cultivars and Sangiovese, as already reported, but also the first evidences of the relationships between Nero d’Avola and both Inzolia and Catarratto. Finally, a small panel of highly informative markers (12 SNPs) allowed us to isolate a private profile for each Sicilian cultivar, providing a new tool for cultivar identification

Studies on Improving the Efficiency of Somatic Embryogenesis in Grapevine (<i>Vitis vinifera</i> L.) and Optimising Ethyl Methanesulfonate Treatment for Mutation Induction

Somatic embryogenesis (SE) has many applications in grapevine biotechnology including micropropagation, eradicating viral infections from infected cultivars, mass production of hypocotyl explants for micrografting, as a continuous source for haploid and doubled haploid plants, and for germplasm conservation. It is so far the only pathway for the genetic modification of grapevines through transformation. The single-cell origin of somatic embryos makes them an ideal explant for mutation breeding as the resulting mutants will be chimera-free. In the present research, two combinations of plant growth regulators and different explants from flower buds at two stages of maturity were tested in regard to the efficiency of callusing and embryo formation from the callus produced in three white grape cultivars. Also, the treatment of somatic embryos with the chemical mutagen ethyl methanesulfonate (EMS) was optimised. Medium 2339 supplemented with β-naphthoxyacetic acid (5 μM) and 6-benzylaminopurine (BAP—9.0 μM) produced significantly more calluses than medium 2337 supplemented with 2,4-dichlorophenoxyacetic acid (4.5 µM) and BAP (8.9 µM) in all explants. The calluses produced on medium 2337 were harder and more granular and produced more SEs. Although the stage of the maturity of floral bud did not have a significant effect on the callusing of the explants, calluses produced from immature floral bud explants in the premeiotic stage produced significantly more SEs than those from more mature floral buds. Overall, immature ovaries and cut floral buds exposing the cut ends of filaments, style, etc., tested for the first time in grapevine SE, produced the highest percentage of embryogenic calluses. It is much more efficient to cut the floral bud and culture than previously reported explants such as anthers, ovaries, stigmas and styles during the short flowering period when the immature flower buds are available. When the somatic embryos of the three cultivars were incubated for one hour with 0.1% EMS, their germination was reduced by 50%; an ideal treatment considered to obtain a high frequency of mutations for screening. Our research findings will facilitate more efficient SE induction in grapevines and inducing mutations for improving individual traits without altering the genetic background of the cultivar