137 research outputs found
Recommended from our members
The structural effect of Methyl substitution on the binding of Polypyridyl Ru-dppz Complexes to DNA
ABSTRACT: Polypyridyl ruthenium complexes have been intensively studied and possess photophysical properties which are both interesting and useful. They can act as probes for DNA, with a substantial enhancement in emission when bound, and can induce DNA damage upon photoirradiation and therefore, the synthesis and characterization of DNA binding of new complexes is an area of intense research activity. Whilst knowledge of how the binding of derivatives compares to the parent compound is highly desirable, this information can be difficult to obtain. Here we report the synthesis of three new methylated complexes, [Ru(TAP)2(dppz-10-Me).2Cl, [Ru(TAP)2(dppz-10,12-Me2)].2Cl and [Ru(TAP)2(dppz-11-Me)].2Cl, and examine the consequences for DNA binding through the use of atomic resolution X-ray crystallography. We find that the methyl groups are located in discrete positions with a complete directional preference. This may help to explain the quenching behavior which is found in solution for analogous [Ru(phen)2(dppz)]2+ derivatives
Recommended from our members
Conformational modulation of sequence recognition in synthetic macromolecules
The different triplet sequences in high molecular weight aromatic copolyimides comprising pyromellitimide units ("I") flanked by either ether-ketone ("K") or ether-sulfone residues ("S") show different binding strengths for pyrene-based tweezer-molecules. Such molecules bind primarily to the diimide unit through complementary π-π-stacking and hydrogen bonding. However, as shown by the magnitudes of 1H NMR complexation shifts and tweezer-polymer binding constants, the triplet "SIS" binds tweezer-molecules more strongly than "KIS" which in turn bind such molecules more strongly than "KIK". Computational models for tweezer-polymer binding, together with single-crystal X-ray analyses of tweezer-complexes with macrocyclic ether-imides, reveal that the variations in binding strength between the different triplet sequences arise from the different conformational preferences of aromatic rings at diarylketone and diarylsulfone linkages. These preferences determine whether or not chain-folding and secondary π−π-stacking occurs between the arms of the tweezermolecule and the 4,4'-biphenylene units which flank the central diimide residue
Recommended from our members
Structural studies reveal the enantiospecific recognition of a DNA G-quadruplex by a ruthenium polypyridyl complex
Using X-ray crystallography, we show an enantiospecificity in DNA G-quadruplex binding, using the complexes Λ/∆-[Ru(TAP)2(dppz-11-CN)]2+ (TAP=1,4,5,8-tetraazaphenanthrene) containing the dppz (dipyridophenazine) ligand, paralleling the specificity of the complexes with duplex DNA. The Λ complex crystallises with the normally parallel stranded d(TAGGGTTA) tetraplex to give the first such antiparallel strand assembly in which syn-guanosine is adjacent to the complex at the 5’ end of the quadruplex core. SRCD measurements confirm that the same conformational switch occurs in solution. The Δ enantiomer, by contrast, is present in the structure but stacked at the ends of the assembly. In addition, we report the structure of Λ-[Ru(phen)2(11-CN-dppz)]2+ bound to d(TCGGCGCCGA), a duplex forming sequence, and use both structural models to aid in the elucidation of the motif-specific luminescence response of the isostructural phen analogue enantiomers
Recommended from our members
Delta chirality ruthenium ‘light-switch’ complexes can bind in the minor groove of DNA with five different binding modes
[Ru(phen)2(dppz)]2+ has been studied since the 1990s due to its “light-switch” properties. It can be used as a luminescent DNA probe, with emission switched on through DNA binding. The luminescence observed is dependent on the solvent accessibility of the pyrazine nitrogen atoms, and therefore is sensitive to changes in both binding site of the cation and chromophore orientation. The compound is also chiral, and there are distinct differences between the enantiomers in terms of the emission behaviour when bound to a variety of DNA sequences. Whilst a number of binary DNA-complex X-ray crystal structures is available, most include the Λ enantiomer, and there is very little structural information about binding of the Δ enantiomer. Here we present the first X-ray crystal structure of a Δ enantiomer bound to well-matched DNA, in the absence of the other, Λ, enantiomer. We show how the binding site observed here can be related to a more general pattern of motifs in the crystallographic literature and propose that the Δ enantiomer can bind with five different binding modes, offering a new hypothesis for the interpretation of solution data
Recommended from our members
Controlled dehydration of a ruthenium complex-DNA crystal induces reversible DNA kinking
Hydration-dependent DNA deformation has been known since Rosalind Franklin recognised that the relative humidity of the sample had to be maintained to observe a single conformation in DNA fibre diffraction. We now report for the first time the crystal structure, at the atomic level, of a dehydrated form of a DNA duplex and demonstrate the reversible interconversion to the hydrated form at room temperature. This system, containing d(TCGGCGCCGA) in the presence of Λ-[Ru(TAP)2(dppz)]2+ (TAP = 1,4,5,8-tetraazaphenanthrene, dppz = dipyridophenazine), undergoes a partial transition from an A/B hybrid to the A-DNA conformation, at 84-79% relative humidity. This is accompanied by an increase in kink at the central step from 22° to 51°, with a large movement of the terminal bases forming the intercalation site. This transition is reversible on rehydration. Seven datasets, collected from one crystal at room temperature, show the consequences of dehydration at near-atomic resolution. This result highlights that crystals, traditionally thought of as static systems, are still dynamic and therefore can be the subject of further experimentation
Recommended from our members
Direct observation by time-resolved infrared spectroscopy of the bright and the dark excited states of the [Ru(phen)2(dppz)]2+ light-switch compound in solution and when bound to DNA
The [Ru(phen)2(dppz)]2+ complex (1) is non-emissive in water but is highly luminescent in organic solvents
or when bound to DNA, making it a useful probe for DNA binding. To date, a complete mechanistic explanation for this “light-switch” effect is still lacking. With this in mind we have undertaken an ultrafast time resolved infrared (TRIR) study of 1 and directly observe marker bands between 1280–1450 cm-1, which characterise both the emissive “bright” and the non-emissive “dark” excited states of the complex, in CD3CN and D2O respectively. These characteristic spectral features are present in the [Ru(dppz)3]2+ solvent light-switch complex but absent in [Ru(phen)3]2+, which is luminescent in both solvents. DFT
calculations show that the vibrational modes responsible for these characteristic bands are predominantly localised on the dppz ligand. Moreover, they reveal that certain vibrational modes of the “dark” excited state couple with vibrational modes of two coordinating water molecules, and through these to the bulk solvent, thus providing a new insight into the mechanism of the light-switch effect. We also demonstrate that the marker bands for the “bright” state are observed for both L- and D enantiomers of 1 when bound to DNA and that photo-excitation of the complex induces perturbation of
the guanine and cytosine carbonyl bands. This perturbation is shown to be stronger for the L enantiomer, demonstrating the different binding site properties of the two enantiomers and the ability of
this technique to determine the identity and nature of the binding site of such intercalators
Recommended from our members
Ruthenium polypyridyl complex bound to a unimolecular chair-form G-quadruplex
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, con-sistent with its transient formation in live cells. The stabilisation of a particular topology by a small molecule is of great importance for therapeutic applications. Here we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays en-antiospecific G-quadruplex binding. It crystallised in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterised example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a compar-ative ligand binding study, we showed, using a Klenow fragment assay, that the title complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work
The GANIL control system as seen from the control room
http://accelconf.web.cern.ch/AccelConf/c81/papers/fp-08.pdfInternational audienc
Amphipathic DNA polymers exhibit antiviral activity against systemic Murine Cytomegalovirus infection
<p>Abstract</p> <p>Background</p> <p>Phosphorothioated oligonucleotides (PS-ONs) have a sequence-independent, broad spectrum antiviral activity as amphipathic polymers (APs) and exhibit potent in vitro antiviral activity against a broad spectrum of herpesviruses: HSV-1, HSV-2, HCMV, VZV, EBV, and HHV-6A/B, and in vivo activity in a murine microbiocide model of genital HSV-2 infection. The activity of these agents against animal cytomegalovirus (CMV) infections in vitro and in vivo was therefore investigated.</p> <p>Results</p> <p>In vitro, a 40 mer degenerate AP (REP 9) inhibited both murine CMV (MCMV) and guinea pig CMV (GPCMV) with an IC<sub>50 </sub>of 0.045 μM and 0.16 μM, respectively, and a 40 mer poly C AP (REP 9C) inhibited MCMV with an IC<sub>50 </sub>of 0.05 μM. Addition of REP 9 to plaque assays during the first two hours of infection inhibited 78% of plaque formation whereas addition of REP 9 after 10 hours of infection did not significantly reduce the number of plaques, indicating that REP 9 antiviral activity against MCMV occurs at early times after infection. In a murine model of CMV infection, systemic treatment for 5 days significantly reduced virus replication in the spleens and livers of infected mice compared to saline-treated control mice. REP 9 and REP 9C were administered intraperitoneally for 5 consecutive days at 10 mg/kg, starting 2 days prior to MCMV infection. Splenomegaly was observed in infected mice treated with REP 9 but not in control mice or in REP 9 treated, uninfected mice, consistent with mild CpG-like activity. When REP 9C (which lacks CpG motifs) was compared to REP 9, it exhibited comparable antiviral activity as REP 9 but was not associated with splenomegaly. This suggests that the direct antiviral activity of APs is the predominant therapeutic mechanism <it>in vivo</it>. Moreover, REP 9C, which is acid stable, was effective when administered orally in combination with known permeation enhancers.</p> <p>Conclusion</p> <p>These studies indicate that APs exhibit potent, well tolerated antiviral activity against CMV infection in vivo and represent a new class of broad spectrum anti-herpetic agents.</p
Recommended from our members
Monitoring one-electron photo-oxidation of guanine in DNA crystals using ultrafast infrared spectroscopy
To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl–DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium
- …