PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10³ bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial

Detecção de Histophilus somni (Haemophilus somnus) no sêmen bovino mediante reação em cadeia pela polimerase (PCR)

The present study evaluated the use of PCR for Histophilus somni detection in bovine semen. Semen samples were experimentally infected with H. somni at dilutions ranging from 107 to 101 bacteria/mL and subjected to DNA extraction by the phenol/chloroform method, followed by PCR amplification. The amplification products were analyzed by electrophoresis in 8% acrylamide gel. The oligonucleotide primers used yielded an amplification fragment of 400 base pairs from the bacterial DNA. Positive amplification was obtained even for the 101 bacteria/mL dilution. PCR proved to be an efficient method for the detection of H. somni. The results obtained in this study have brought relevant information for the diagnosis of H. somni, justifying the need for the diagnosis of this bacterium in bulls, especially in semen samples that should be free of contamination. The PCR method has shown to be a useful tool for the quality control of semen produced in artificial insemination centers.O presente estudo avaliou o uso da PCR para a detecção do Histophilus somni no sêmen bovino. Amostras de sêmen foram contaminadas experimentalmente com H. somni diluída em escalas de 107 a 101 bactérias/ mL, submetidas à extração de DNA pelo método de fenol/clorofórmio e amplificadas pela PCR. Os produtos da amplificação do DNA foram analisados por eletroforese em gel de acrilamida 8%. Por meio de oligonucleotídeos iniciadores obteve-se a amplificação de um fragmento de 400 pares de bases a partir do DNA da bactéria. Conseguiu-se amplificação positiva até na diluição de 101 bactérias/mL. A PCR mostrou-se eficiente na detecção de H. somni. O resultado disponibiliza conhecimento relevante para o diagnóstico de H. somni, justificando a necessidade do diagnóstico dessa bactéria em reprodutores, especialmente em amostras de sêmen, que deveriam estar livres de qualquer contaminação. A PCR mostrou-se como uma valiosa ferramenta no controle da qualidade do sêmen produzido em centrais de inseminação artificial

ATLANTIC BIRD TRAITS: a data set of bird morphological traits from the Atlantic forests of South America

Scientists have long been trying to understand why the Neotropical region holds the highest diversity of birds on Earth. Recently, there has been increased interest in morphological variation between and within species, and in how climate, topography, and anthropogenic pressures may explain and affect phenotypic variation. Because morphological data are not always available for many species at the local or regional scale, we are limited in our understanding of intra- and interspecies spatial morphological variation. Here, we present the ATLANTIC BIRD TRAITS, a data set that includes measurements of up to 44 morphological traits in 67,197 bird records from 2,790 populations distributed throughout the Atlantic forests of South America. This data set comprises information, compiled over two centuries (1820–2018), for 711 bird species, which represent 80% of all known bird diversity in the Atlantic Forest. Among the most commonly reported traits are sex (n = 65,717), age (n = 63,852), body mass (n = 58,768), flight molt presence (n = 44,941), molt presence (n = 44,847), body molt presence (n = 44,606), tail length (n = 43,005), reproductive stage (n = 42,588), bill length (n = 37,409), body length (n = 28,394), right wing length (n = 21,950), tarsus length (n = 20,342), and wing length (n = 18,071). The most frequently recorded species are Chiroxiphia caudata (n = 1,837), Turdus albicollis (n = 1,658), Trichothraupis melanops (n = 1,468), Turdus leucomelas (n = 1,436), and Basileuterus culicivorus (n = 1,384). The species recorded in the greatest number of sampling localities are Basileuterus culicivorus (n = 243), Trichothraupis melanops (n = 242), Chiroxiphia caudata (n = 210), Platyrinchus mystaceus (n = 208), and Turdus rufiventris (n = 191). ATLANTIC BIRD TRAITS (ABT) is the most comprehensive data set on measurements of bird morphological traits found in a biodiversity hotspot; it provides data for basic and applied research at multiple scales, from individual to community, and from the local to the macroecological perspectives. No copyright or proprietary restrictions are associated with the use of this data set. Please cite this data paper when the data are used in publications or teaching and educational activities. © 2019 The Authors. Ecology © 2019 The Ecological Society of Americ

ATLANTIC BIRD TRAITS

Scientists have long been trying to understand why the Neotropical region holds the highest diversity of birds on Earth. Recently, there has been increased interest in morphological variation between and within species, and in how climate, topography, and anthropogenic pressures may explain and affect phenotypic variation. Because morphological data are not always available for many species at the local or regional scale, we are limited in our understanding of intra- and interspecies spatial morphological variation. Here, we present the ATLANTIC BIRD TRAITS, a data set that includes measurements of up to 44 morphological traits in 67,197 bird records from 2,790 populations distributed throughout the Atlantic forests of South America. This data set comprises information, compiled over two centuries (1820–2018), for 711 bird species, which represent 80% of all known bird diversity in the Atlantic Forest. Among the most commonly reported traits are sex (n = 65,717), age (n = 63,852), body mass (n = 58,768), flight molt presence (n = 44,941), molt presence (n = 44,847), body molt presence (n = 44,606), tail length (n = 43,005), reproductive stage (n = 42,588), bill length (n = 37,409), body length (n = 28,394), right wing length (n = 21,950), tarsus length (n = 20,342), and wing length (n = 18,071). The most frequently recorded species are Chiroxiphia caudata (n = 1,837), Turdus albicollis (n = 1,658), Trichothraupis melanops (n = 1,468), Turdus leucomelas (n = 1,436), and Basileuterus culicivorus (n = 1,384). The species recorded in the greatest number of sampling localities are Basileuterus culicivorus (n = 243), Trichothraupis melanops (n = 242), Chiroxiphia caudata (n = 210), Platyrinchus mystaceus (n = 208), and Turdus rufiventris (n = 191). ATLANTIC BIRD TRAITS (ABT) is the most comprehensive data set on measurements of bird morphological traits found in a biodiversity hotspot; it provides data for basic and applied research at multiple scales, from individual to community, and from the local to the macroecological perspectives. No copyright or proprietary restrictions are associated with the use of this data set. Please cite this data paper when the data are used in publications or teaching and educational activities. © 2019 The Authors. Ecology © 2019 The Ecological Society of Americ

Brazilian Flora 2020: Leveraging the power of a collaborative scientific network

International audienceThe shortage of reliable primary taxonomic data limits the description of biological taxa and the understanding of biodiversity patterns and processes, complicating biogeographical, ecological, and evolutionary studies. This deficit creates a significant taxonomic impediment to biodiversity research and conservation planning. The taxonomic impediment and the biodiversity crisis are widely recognized, highlighting the urgent need for reliable taxonomic data. Over the past decade, numerous countries worldwide have devoted considerable effort to Target 1 of the Global Strategy for Plant Conservation (GSPC), which called for the preparation of a working list of all known plant species by 2010 and an online world Flora by 2020. Brazil is a megadiverse country, home to more of the world's known plant species than any other country. Despite that, Flora Brasiliensis, concluded in 1906, was the last comprehensive treatment of the Brazilian flora. The lack of accurate estimates of the number of species of algae, fungi, and plants occurring in Brazil contributes to the prevailing taxonomic impediment and delays progress towards the GSPC targets. Over the past 12 years, a legion of taxonomists motivated to meet Target 1 of the GSPC, worked together to gather and integrate knowledge on the algal, plant, and fungal diversity of Brazil. Overall, a team of about 980 taxonomists joined efforts in a highly collaborative project that used cybertaxonomy to prepare an updated Flora of Brazil, showing the power of scientific collaboration to reach ambitious goals. This paper presents an overview of the Brazilian Flora 2020 and provides taxonomic and spatial updates on the algae, fungi, and plants found in one of the world's most biodiverse countries. We further identify collection gaps and summarize future goals that extend beyond 2020. Our results show that Brazil is home to 46,975 native species of algae, fungi, and plants, of which 19,669 are endemic to the country. The data compiled to date suggests that the Atlantic Rainforest might be the most diverse Brazilian domain for all plant groups except gymnosperms, which are most diverse in the Amazon. However, scientific knowledge of Brazilian diversity is still unequally distributed, with the Atlantic Rainforest and the Cerrado being the most intensively sampled and studied biomes in the country. In times of “scientific reductionism”, with botanical and mycological sciences suffering pervasive depreciation in recent decades, the first online Flora of Brazil 2020 significantly enhanced the quality and quantity of taxonomic data available for algae, fungi, and plants from Brazil. This project also made all the information freely available online, providing a firm foundation for future research and for the management, conservation, and sustainable use of the Brazilian funga and flora