A Note on the Radiative and Collisional Branching Ratios in Polarized Radiation Transport with Coherent Scattering

We discuss the implementation of physically meaningful branching ratios between the CRD and PRD contributions to the emissivity of a polarized multi-term atom in the presence of both inelastic and elastic collisions. Our derivation is based on a recent theoretical formulation of partially coherent scattering, and it relies on a heuristic diagrammatic analysis of the various radiative and collisional processes to determine the proper form of the branching ratios. The expression we obtain for the emissivity is $\varepsilon=\left[\varepsilon^{\tiny (1)}-\varepsilon^{\tiny (2)}_{\rm f.s.} \right]+\varepsilon^{\tiny (2)}$, where $\varepsilon^{\tiny (1)}$ and $\varepsilon^{\tiny (2)}$ are the emissivity terms for the redistributed and partially coherent radiation, respectively, and where "f.s." implies that the corresponding term must be evaluated assuming a flat-spectrum average of the incident radiation

A gravitational wave window on extra dimensions

We report on the possibility of detecting a submillimetre-sized extra dimension by observing gravitational waves (GWs) emitted by pointlike objects orbiting a braneworld black hole. Matter in the `visible' universe can generate a discrete spectrum of high frequency GWs with amplitudes moderately weaker than the predictions of general relativity (GR), while GW signals generated by matter on a `shadow' brane hidden in the bulk are potentially strong enough to be detected using current technology. We know of no other astrophysical phenomena that produces GWs with a similar spectrum, which stresses the need to develop detectors capable of measuring this high-frequency signature of large extra dimensions.Comment: 9 pages, 5 figure

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Intravenous infusion of magnesium sulfate and its effect on horses with trigeminal-mediated headshaking.

BackgroundTrigeminal-mediated headshaking results from low-threshold firing of the trigeminal nerve resulting in apparent facial pain. Magnesium may have neuroprotective effects on nerve firing that potentially dampen signs of neuropathic pain. This hypothesis has not been investigated in horses with trigeminal-mediated headshaking.ObjectiveTo investigate head-shaking behavior in affected horses after IV magnesium sulfate infusion.AnimalsSix geldings with trigeminal-mediated headshaking.MethodsProspective randomized crossover study. Horses were controlled for diet and infused IV with 5% dextrose solution (DS; control solution at 2 mL/kg body weight [BW]) and MgSO4 50% solution (MSS at 40 mg/kg BW). Head-shaking behavior was recorded at times T0 (baseline, before infusion) and T15, T30, T60, and T120 minutes post-infusion. Venous blood variables such as pH, HCO3 - , standard base excess (SBE), Na+ , Cl- , K+ , Ca2+ , Mg2+ , total magnesium (tMg), glucose, and lactate were measured; strong ion difference (SID) and anion gap (AG) were calculated for each time point.ResultsBlood variables including pH, Na+ , Cl- , K+ , SID, AG, lactate, Ca2+ , tMg, and Mg2+ had significant changes with MSS as compared to DS treatment. Glucose, SBE, and HCO3 - did not have significant changes. A 29% reduction in head-shaking rate occurred after MSS treatment but no change occurred after DS treatment.Conclusions and clinical importanceAdministration of MSS IV increased plasma total and ionized magnesium concentrations and significantly decreased head-shaking behavior in horses with trigeminal-mediated headshaking

Accurate time-domain gravitational waveforms for extreme-mass-ratio binaries

The accuracy of time-domain solutions of the inhomogeneous Teukolsky equation is improved significantly. Comparing energy fluxes in gravitational waves with highly accurate frequency-domain results for circular equatorial orbits in Schwarzschild and Kerr, we find agreement to within 1% or better, which we believe can be even further improved. We apply our method to orbits for which frequency-domain calculations have a relative disadvantage, specifically high-eccentricity (elliptical and parabolic) "zoom-whirl" orbits, and find the energy fluxes, waveforms, and characteristic strain in gravitational waves.Comment: 6 pages, 9 figures, 2 tables; Changes: some errors corrected. Comparison with Frequency-domain now done in stronger fiel

The Río Cañete Basin: Implications for the Mesozoic geoynamic evolution of the Peruvian margin

The evolution of the Río Cañete Basin provides a robust geodynamic model that can be extrapolated throughout the Peruvian margin. Transtensional crustal attenuation during the Jurassic early stages of Andean oblique subduction accounts for major crustal thinning and regional arc volcanism. Arrival of the lost “Chivaterous Plateau”, explains the termination of the Jurassic arc and development of a Neocomian shallow subduction and slab breakoff. Regional marine transgression was accompanied by patchy arc volcanism as well as localized subduction of an oceanic fracture. Protracted and persistent transtension supports the Albian/Cenomanian high rates of extension and upwelling of primitive mantle. The Jurassic calc-alkaline intra-arc is unbroken and displays different degrees of crustal contamination as documented in the Puente Piedra Group. Subduction slab input is displayed by the negative Nb and Ti anomaly. However, the LREE enrichment and moderately slope similar to the OIB contrast with the MREE and HREE gentler slope. The overall flattening and discrete HREE spoon shape suggest pyroxene and subordinate amphibole fractioning. Still, the negative Eu anomaly, and more siliceous magmatism in the south supports the significant feldspar fractioning and higher crustal contamination. Subduction Flattening during approach of an oceanic plateau triggered the abrupt collapsing and drowning of the Jurassic arc edifice and the sharp provenance change from a volcanic to a quartz rich basement source. Still, the timing and uplift of the Marañon Block and the Arequipa Massif, the synchronous subsidence between these basement uplifts, the Neocomian volcanic lull, and the restricted deposition of this Neocomian quartz rich clastic wedge west of the Marañon Block bolsters a Neocomian flat slab. The presence of 145-110 Ma alkaline to subalkaline basalts and andesites lavas along a linear belt west of the Marañon Block supports the slab breakoff. The chondrite normalized REE patterns amid OIB and EMORB, with almost flat HREE and almost absence of crustal contamination suggest amphibole and pyroxene fractioning. The continuous marine transgression is recorded by the shales and limestones of the Lima Group that terminated during Aptian times. The localized and anomalous subaqueous Pucusana Formation volcanism was associated with subduction of an oceanic fracture coeval with mantle upwelling. Indeed, the gently LREE and MREE slope and almost flat HREE chondrite normalized spider diagrams suggest pyroxene fractioning. The almost continuous transtension set up since the early Mesozoic triggered the large pull-apart basin developed during the Albian/Cenomanian. The basins thus developed, were characterized by variable crustal attenuation and subsidence and thick volcaniclastic deposition. The strong Nb negative anomaly in the Casma Group implied subduction slab input. But, the gentle and higher enrichment in LREE similar to OIB, and the almost flat HREE akin to EMORB and NMORB with and overall subtle Eu anomaly showed a significant contribution from undepleted mantle and important pyroxene fractionation

Luteinizing hormone concentrations in healthy horses and horses with trigeminal-mediated headshaking over an 8-hour period.

BackgroundTrigeminal-mediated headshaking results from a low threshold for firing of the trigeminal nerve. A seasonal component has been implicated in onset of clinical signs, which occur during the spring and summer months. Geldings are overrepresented in the affected population and hormonal differences as compared to a healthy control population of geldings might contribute to headshaking.Objective/hypothesisTo assess concentrations of luteinizing hormone (LH) over an 8-hour period in gelded healthy controls and horses affected with headshaking. Our hypothesis was that geldings with seasonal headshaking would have higher concentrations of LH over an 8-hour period compared to control horses during the summer when affected horses manifested headshaking.AnimalsTwelve geldings (6 controls and 6 affected).MethodsProspective controlled trial. Blood samples were drawn every 15 minutes over an 8-hour time period during summer from all horses to measure circulating LH concentrations by using a radioimmunoassay for equine LH. All affected horses were actively affected by headshaking at the time of sample collection.ResultsNo statistically significant differences in LH concentrations were found throughout the study period in headshakers as compared to control horses. Time had no significant effect, but a slight decrease in LH concentrations was observed for all horses. The main limitation of the study was the low number of horses.Conclusions and clinical importanceHorses affected with headshaking did not have significant differences in circulating LH during the late summer as compared to control horses

An alternative Mesozoic geodynamic model for the evolution of the Central Coastal ranges of Peru: the Rio Cañete Basin

Integration of detailed stratigraphic, sedimentologic and tectonic studies of the Río Cañete Basin with opening and divergence rates of the South Atlantic Ocean, overriding plate velocity, trench migration, subducting age (Fig. 1) etc. and the protracted Mesozoic Farallon Plate oblique convergence parameters provide new lines of evidence to suggest an alternative model for the evolution of the Peruvian margin. These unorthodox model departures significantly from the classic and simplistic Andean Model used in the literature. The western margin of Gondwana experience severe lithosphere extension coeval with arc magmatism since at least Middle Triassic. Actually, only the uppermost Jurassic unit is displayed along the Río Cañete Basin, however, it is important to take into account that northward the Jurassic arc sequence terminates against the accreted Amotape/Olmos Terrain and it overlies the Late Triassic to Jurassic Pucara Group. Slab stagnation in the mantle transition zone near the upper and lower mantle boundary perhaps triggered shallow subduction, which in turn caused drowning and Jurassic arc volcanism termination. Slab flattening increased upper plate stress coupling transferring the stresses eastward and causing basement-core block uplift and changing provenance to quartz-rich. Slab breakoff occurred soon after the water-bearing serpentinized slab changed to denser eclogite facies as recorded by linear alkaline volcanism with strong mantle source (low La/Nb ratio) along the high Andes. Locally, transform fault subduction enhanced fracturing during slab bending permitting the tapping of undepleted mantle by these deep faults and causing trench parallel extension coeval with explosive subaqueous volcanism with strong OIB signature (low La/Nb ratio). Higher South Atlantic spreading rates than the trench normal convergence imparted the mechanism for trench rollback, thus enhancing the upper plate extensional deformation. Aptian increase in spreading rates coeval with protracted increase in the normal absolute plate motion terminated the active basement uplift; however, they persisted as submerged highs allowing the diachronous northsouth encroaching of the Cretaceous epeiric sea in along the Marañón and Ucayali basins. Prolonged Farallón Plate oblique convergence triggered strain partitioning and set-up important strike slip deformation such as the Tapacocha and Hormigas faults. Basin development involved pervasive transtensional deformation and tectonic segmentation and each one distinguished by its own stratigraphy, geochemistry, heat flow and subsidence history. Transtensional deformation involved deep crustal faults and complex lithosphere boudinage permitting important asthenospheric mantle de- compression melting magmatism that mixed with partially metasomatized subduction slab as documented by relative low La/Yb and La/Nb ratios and the occurrence of Nb-Ta negative anomalies. Two distinctive magmatic regimes are separated by an important and major plutonic regime linked to the emplacement of the Peruvian Costal Batholith (PCB) encompassing episodic multi-scale stopping, caldron subsidence and assimilation. The oldest volcanic regime (Casma Group), has higher mantle contribution and insignificant crustal contamination compare to the younger one (Quilmaná Formation). However, locally detrital zircons (DZ) and Hf isotopes support the presence of juvenile zircons supporting the absence of crustal contamination

Individuals with Disabilities Education Act Reauthorization Legislation: An Overview

CRS Report for Congress entailing information about The Individuals with Disabilities Education Act (IDEA) reauthorization legislation. Topics include, legislation within the 105th Congress, local relief, educational improvements, allocation formulas, etc.