Circulating insulin-like growth factor I modulates mood and is a biomarker of vulnerability to stress:from mouse to man

Individual susceptibility to anxiety disorders after maladaptive responses to stress is not well understood. We now report that while exploring stress responses in mice after traumatic brain injury (TBI), a condition associated to stress susceptibility, we observed that the anxiogenic effects of either TBI or exposure to life-threatening experiences (predator) were blocked when both stressors were combined. Because TBI increases the entrance into the brain of serum insulin-like growth factor I (IGF-I), a known modulator of anxiety with a wide range of concentrations in the human population, we then determined whether circulating IGF-I is related to anxiety measures. In mice, anxiety-like responses to predator were inversely related to circulating IGF-I levels. Other indicators of mood regulation such as sensitivity to dexamethasone suppression and expression levels of blood and brain FK506 binding protein 5 (FKBP5), a co-chaperone of the glucocorticoid receptor that regulates its activity, were also associated to circulating IGF-I. Indeed, brain FKBP5 expression in mice was stimulated by IGF-I. In addition, we observed in a large human cohort (n = 2686) a significant relationship between plasma IGF-I and exposure to recent stressful life events, while FKBP5 expression in blood cells was significantly associated to plasma IGF-I levels. Collectively, these data indicate that circulating IGF-I appears to be involved in mood homeostasis across different species. Furthermore, the data in mice allow us to indicate that IGF-I may be acting at least in part by modulating FKBP5 expression

Effects of magnesium with or without boron on headshaking behavior in horses with trigeminal-mediated headshaking.

BackgroundOral administration of magnesium and boron might have a beneficial effect on headshaking behavior in horses.ObjectiveEvaluate the effects of oral magnesium alone or in combination with boron on headshaking behavior in affected horses.AnimalsTwelve geldings (6 healthy controls and 6 affected).MethodsProspective randomized controlled dietary trial over 42 days in 12 horses (6 horses diagnosed with trigeminal-mediated headshaking and 6 unaffected healthy controls). All horses received a hay diet and were randomized into 3 treatment groups: pelleted feed combination (PF), pelleted feed combination with magnesium (M), and pelleted feed combination with magnesium-boron (MB) with a week washout of hay only between treatments. Headshaking behavior and biochemical blood variables were assessed at baseline (hay only) and then after each week of supplementation.ResultsAll 3 diet interventions increased blood ionized and total magnesium. Groups M and MB further increased Mg2+ when compared to PF. Horses receiving treatments had a significant reduction in headshaking behavior, as measured by incidence rate ratio (IRR), when compared to unsupplemented hay diet (44% for PF, IRR, 0.558; CI, 0.44, 0.72; P < .001; 52% for M, IRR, 0.476; CI, 0.37, 0.62; P < .001; and 64% for MB, IRR, 0.358; CI, 0.27, 0.48; P < .001).Conclusions and clinical importanceMagnesium in combination with boron had the greatest decrease in headshaking. Oral supplementation with magnesium or magnesium in combination with boron should be considered in horses affected with headshaking

Pneumonia Caused by Klebsiella spp. in 46 Horses.

BackgroundKlebsiella spp. are implicated as a common cause of bacterial pneumonia in horses, but few reports describe clinical presentation and disease progression.Hypothesis/objectivesTo describe the signalment, clinicopathologic data, radiographic and ultrasonographic findings, antimicrobial susceptibility, outcome, and pathologic lesions associated with Klebsiella spp. pneumonia in horses.AnimalsForty-six horses from which Klebsiella spp. was isolated from the lower respiratory tract.MethodsRetrospective study. Medical records from 1993 to 2013 at the William R. Pritchard Veterinary Medical Teaching Hospital, University of California, Davis were reviewed. Exact logistic regression was performed to determine if any variables were associated with survival to hospital discharge.ResultsSurvival in horses <1 year old was 73%. Overall survival in adults was 63%. For adults in which Klebsiella pneumoniae was the primary isolate, survival was 52%. Mechanical ventilation preceded development of pneumonia in 11 horses. Complications occurred in 25/46 horses, with thrombophlebitis and laminitis occurring most frequently. Multi-drug resistance was found in 47% of bacterial isolates. Variables that significantly impacted survival included hemorrhagic nasal discharge, laminitis, and thoracic radiographs with a sharp demarcation between marked caudal pulmonary alveolar infiltration and more normal-appearing caudodorsal lung.Conclusions and clinical importanceKlebsiella spp. should be considered as a differential diagnosis for horses presenting with hemorrhagic pneumonia and for horses developing pneumonia after mechanical ventilation. Multi-drug resistance is common. Prognosis for survival generally is fair, but is guarded for adult horses in which K. pneumoniae is isolated as the primary organism

Accurate time-domain gravitational waveforms for extreme-mass-ratio binaries

The accuracy of time-domain solutions of the inhomogeneous Teukolsky equation is improved significantly. Comparing energy fluxes in gravitational waves with highly accurate frequency-domain results for circular equatorial orbits in Schwarzschild and Kerr, we find agreement to within 1% or better, which we believe can be even further improved. We apply our method to orbits for which frequency-domain calculations have a relative disadvantage, specifically high-eccentricity (elliptical and parabolic) "zoom-whirl" orbits, and find the energy fluxes, waveforms, and characteristic strain in gravitational waves.Comment: 6 pages, 9 figures, 2 tables; Changes: some errors corrected. Comparison with Frequency-domain now done in stronger fiel

A gravitational wave window on extra dimensions

We report on the possibility of detecting a submillimetre-sized extra dimension by observing gravitational waves (GWs) emitted by pointlike objects orbiting a braneworld black hole. Matter in the `visible' universe can generate a discrete spectrum of high frequency GWs with amplitudes moderately weaker than the predictions of general relativity (GR), while GW signals generated by matter on a `shadow' brane hidden in the bulk are potentially strong enough to be detected using current technology. We know of no other astrophysical phenomena that produces GWs with a similar spectrum, which stresses the need to develop detectors capable of measuring this high-frequency signature of large extra dimensions.Comment: 9 pages, 5 figure

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Intravenous infusion of magnesium sulfate and its effect on horses with trigeminal-mediated headshaking.

BackgroundTrigeminal-mediated headshaking results from low-threshold firing of the trigeminal nerve resulting in apparent facial pain. Magnesium may have neuroprotective effects on nerve firing that potentially dampen signs of neuropathic pain. This hypothesis has not been investigated in horses with trigeminal-mediated headshaking.ObjectiveTo investigate head-shaking behavior in affected horses after IV magnesium sulfate infusion.AnimalsSix geldings with trigeminal-mediated headshaking.MethodsProspective randomized crossover study. Horses were controlled for diet and infused IV with 5% dextrose solution (DS; control solution at 2 mL/kg body weight [BW]) and MgSO4 50% solution (MSS at 40 mg/kg BW). Head-shaking behavior was recorded at times T0 (baseline, before infusion) and T15, T30, T60, and T120 minutes post-infusion. Venous blood variables such as pH, HCO3 - , standard base excess (SBE), Na+ , Cl- , K+ , Ca2+ , Mg2+ , total magnesium (tMg), glucose, and lactate were measured; strong ion difference (SID) and anion gap (AG) were calculated for each time point.ResultsBlood variables including pH, Na+ , Cl- , K+ , SID, AG, lactate, Ca2+ , tMg, and Mg2+ had significant changes with MSS as compared to DS treatment. Glucose, SBE, and HCO3 - did not have significant changes. A 29% reduction in head-shaking rate occurred after MSS treatment but no change occurred after DS treatment.Conclusions and clinical importanceAdministration of MSS IV increased plasma total and ionized magnesium concentrations and significantly decreased head-shaking behavior in horses with trigeminal-mediated headshaking

The Cesàro operator on Korenblum type spaces of analytic functions

[EN] The spectrum of the CesA ro operator , which is always continuous (but never compact) when acting on the classical Korenblum space and other related weighted Fr,chet or (LB) spaces of analytic functions on the open unit disc, is completely determined. It turns out that such spaces are always Schwartz but, with the exception of the Korenblum space, never nuclear. Some consequences concerning the mean ergodicity of are deduced.The research of the first two authors was partially supported by the projects MTM2013-43540-P and MTM2016-76647-P. The second author gratefully acknowledges the support of the Alexander von Humboldt Foundation.Albanese, A.; Bonet Solves, JA.; Ricker, WJ. (2018). The Cesàro operator on Korenblum type spaces of analytic functions. Collectanea mathematica. 69(2):263-281. https://doi.org/10.1007/s13348-017-0205-7S263281692Albanese, A.A., Bonet, J., Ricker, W.J.: Mean ergodic operators in Fréchet spaces. Ann. Acad. Sci. Fenn. Math. 34, 401–436 (2009)Albanese, A.A., Bonet, J., Ricker, W.J.: Montel resolvents and uniformly mean ergodic semigroups of linear operators. Quaest. Math. 36, 253–290 (2013)Albanese, A.A., Bonet, J., Ricker, W.J.: The Cesàro operator in growth Banach spaces of analytic functions. Integral Equ. Oper. Theory 86, 97–112 (2016)Albanese, A.A., Bonet, J., Ricker, W.J.: The Cesàro operator in the Fréchet spaces $$\ell ^{p+}$$ ℓ p + and $$L^{p-}$$ L p - . Glasgow Math. J. 59, 273–287 (2017)Albanese, A.A., Bonet, J., Ricker, W.J.: The Cesàro operator on power series spaces. Stud. Math. doi: 10.4064/sm8590-2-2017Aleman, A.: A class of integral operators on spaces of analytic functions, In: Proceedings of the Winter School in Operator Theory and Complex Analysis, Univ. Málaga Secr. Publ., Málaga, pp. 3–30 (2007)Aleman, A., Constantin, O.: Spectra of integration operators on weighted Bergman spaces. J. Anal. Math. 109, 199–231 (2009)Aleman, A., Peláez, J.A.: Spectra of integration operators and weighted square functions. Indiana Univ. Math. J. 61, 1–19 (2012)Aleman, A., Persson, A.-M.: Resolvent estimates and decomposable extensions of generalized Cesàro operators. J. Funct. Anal. 258, 67–98 (2010)Aleman, A., Siskakis, A.G.: An integral operator on $$H^p$$ H p . Complex Var. Theory Appl. 28, 149–158 (1995)Aleman, A., Siskakis, A.G.: Integration operators on Bergman spaces. Indiana Univ. Math. J. 46, 337–356 (1997)Barrett, D.E.: Duality between $$A^\infty$$ A ∞ and $$A^{- \infty }$$ A - ∞ on domains with nondegenerate corners, Multivariable operator theory (Seattle, WA, 1993), pp. 77–87, Contemporary Math. Vol. 185, Amer. Math. Soc., Providence (1995)Bierstedt, K.D., Bonet, J., Galbis, A.: Weighted spaces of holomorphic functions on bounded domains. Mich. Math. J. 40, 271–297 (1993)Bierstedt, K.D., Bonet, J., Taskinen, J.: Associated weights and spaces of holomorphic functions. Stud. Math. 127, 137–168 (1998)Bierstedt, K.D., Meise, R., Summers, W.H.: A projective description of weighted inductive limits. Trans. Am. Math. Soc. 272, 107–160 (1982)Bierstedt, K.D., Summers, W.H.: Biduals of weighted Banach spaces of analytic functions. J. Aust. Math. Soc. (Ser. A) 54, 70–79 (1993)Bonet, J., Domański, P., Lindström, M., Taskinen, J.: Composition operators between weighted Banach spaces of analytic functions. J. Aust. Math. Soc. (Ser. A) 64, 101–118 (1998)Diestel, J., Jarchow, H., Tonge, A.: Absolutely Summing Operators. Cambridge University Press, Cambridge (1995)Domenig, T.: Composition operators on weighted Bergman spaces and Hardy spaces. Atomic Decompositions and Diagonal Operators, Ph.D. Thesis, University of Zürich (1997). [Zbl 0909.47025]Domenig, T.: Composition operators belonging to operator ideals. J. Math. Anal. Appl. 237, 327–349 (1999)Dunford, N., Schwartz, J.T.: Linear Operators I: General Theory. 2nd Printing. Wiley Interscience Publ., New York (1964)Edwards, R.E.: Functional Analysis. Theory and Applications. Holt, Rinehart and Winston, New York, Chicago San Francisco (1965)Grothendieck, A.: Topological Vector Spaces. Gordon and Breach, London (1973)Hedenmalm, H., Korenblum, B., Zhu, K.: Theory of Bergman Spaces. Graduate Texts in Mathematics, vol. 199. Springer, New York (2000)Jarchow, H.: Locally Convex Spaces. Teubner, Stuttgart (1981)Korenblum, B.: An extension of the Nevanlinna theory. Acta Math. 135, 187–219 (1975)Krengel, U.: Ergodic Theorems. de Gruyter Studies in Mathematics, vol. 6. Walter de Gruyter Co., Berlin (1985)Lusky, W.: On the isomorphism classes of weighted spaces of harmonic and holomorphic functions. Stud. Math. 175(1), 19–40 (2006)Meise, R., Vogt, D.: Introduction to Functional Analysis. Clarendon Press, Oxford (1997)Melikhov, S.N.: (DFS )-spaces of holomorphic functions invariant under differentiation. J. Math. Anal. Appl. 297, 577–586 (2004)Persson, A.-M.: On the spectrum of the Cesàro operator on spaces of analytic functions. J. Math. Anal Appl. 340, 1180–1203 (2008)Pietsch, A.: Nuclear Locally Convex Spaces. Springer, Berlin (1972)Shields, A.L., Williams, D.L.: Bounded projections, duality and multipliers in spaces of analytic functions. Trans. Am. Math. Soc. 162, 287–302 (1971)Siskakis, A.: Volterra operators on spaces of analytic functions—a survey. In: Proceedings of the First Advanced Course in Operator Theory and Complex Analysis, Univ. Sevilla Serc. Publ., Seville, pp. 51–68 (2006