CHARACTERISTICS OF SELF-ORGANIZATION ACADEMIC ACTIVITY OF STUDENTS OF THE COLLEGE

В статье рассматривается проблема изучения роли психологических характеристик в самоорганизации учебной деятельности студентов колледжа. Автор определяет теоретико-методологические аспекты, эффективные формы и методы изучения самоорганизации учебной деятельности студентов колледжаThe problem of the level of development self-organization of College students. The author describes the theoretical and methodological aspects of effective forms and methods of studying the self-organization of educational activity of students of the Colleg

Extirpation of distal part of the pacreas in the severe erosive intraperitoneal bleeding caused by postoperative necrotic acute pancreatitis

Institutul de chirurgie „A.V. Vishnevskii”, Moscova, Rusia, Al XII-lea Congres al Asociației Chirurgilor „Nicolae Anestiadi” din Republica Moldova cu participare internațională 23-25 septembrie 2015Introducere: Pancreatita acută postoperatorie (PAP) reprezintă o complicație gravă ce apare după o intervenție chirurgicală pe pancreas (P). Incidența ei poate atinge 58,9%, în timp ce formele severe se întîlnesc în 24,2% cazuri (Kubyshkin V.A.). O trăsătură distinctivă este apariția pe fonul acesteia a dehiscenței anastomotice, fistulelor pancreatice (FP) și hemoragiilor erozive (HE). Scopul lucrării: De a aprecia eficacitatea rezecției bontului pancreatic în caz de HE postoperatorie. Material și metode: La 17 pacienți sursa de HE a fost vena lienală și mezenterică superioară, artera hepatică și mezenterică superioară. Toți pacienții au fost distribuiți în 2 grupuri. În primul grup (5 pacienți) intervenția chirurgicală s-a finisat cu suturarea și ligaturarea vaselor, în cel de-al doilea – extirparea bontului pancreatic. HE a apărut în 8-15 zile după operația inițială, în timp ce FP a fost obsevată în toate cazurile. Rezultate: Toți pacienții au suportat intervenție chirurgicală de urgență. Suturarea vasului sîngerînd s-a efectuat în 5 cazuri, dintre care în 3 au fost relevate hemoragii repetate (toți 5 pacienți au decedat). Extirparea bontului distal pancreatic a fost efectuată la 12 pacienți, dintre care 8 au supraviețuit, iar 4 au decedat. În toate cazurile de deces operația a fost efectuată în condiții de anemie posthemoragică severă. Concluzii: Suturarea și ligaturarea vasului sîngerînd în cazul PAP necrotice deseori este neefectivă și se soldează cu decesul pacientului. Profilaxia apariției și tratamentul adecvat al PAP permite prevenirea formării FP și reduce riscul apariției HE. Extirparea bontului distal pancreatic în cazul PAP severe, deși este o intervenție de disperare, poate fi recomandată cu scop curativ.Introduction: Postoperative acute pancreatitis (PAP) is a serious complication that occurs after surgery on the pancreas (P). The incidence can reach 58.9%, while severe forms are encountered in 24.2% cases (Kubyshkin VA). Its distinctive feature is the occurence of anastomotic dehiscence, pancreatic fistulas (PF) and erosive hemorrhage (EH). The aim: To assess the effectiveness of distal pancreatic resection in cases of postoperative EH. Material and methods: In 17 patients the source of EH was superior mesenteric and splenic vein, hepatic and superior mesenteric artery. All patients were divided into 2 groups. In the first group (5 patients) surgery ended with suturing and ligation of vessels in the second group – distal pancreatic resection was performed. EH appeared in 8-15 days after the initial surgery. PF was mentioned in all cases. Results: All patients have undergone emergency surgery. The suture of the bleeding vessel was performed in 5 cases, including 3 cases of repeated bleeding (all 5 patients died). Distal pancreatic resection was performed in 12 patients: 8 pat ients have survived, 4 – died. In all cases of death, the surgery was performed in patients with posthaemorrhagic severe anemia. Conclusions: Suturing and ligation of bleeding vessels in necrotic PAP is inefficient and often leads to death of the patient. The prevention of occurrence and adequate treatment of PAP allows to prevent the PF formation and reduces the risk of EH. Extirpation of distal part of the pancreas cause a severe PAP, though is an desperate operation, but may be recommended for therapeutic purposes

ROLE OF CYTOKINE-MEDIATED MECHANISMS IN DEVELOPMENT OF POST-TRAUMATIC MANDIBULAR OSTEOMYELITIS

Osteomyelitis of the lower jaw is one of the urgent problems of modern medicine. There are many reasons for the evolvement of purulent necrotic processes of the jaw bones, including the role of disorders in the systems of innate and adaptive immunity. The aim of the study was to determine the content of TNFα, IL-17, IL-4 in serum and mixed saliva in patients with uncomplicated mandibular fractures and posttraumatic osteomyelitis to determine the possibility of using these indicators for early diagnosis of posttraumatic complications. The article presents the results of a study of tumor necrosis factor α (TNFα), interleukin-17 (IL-17) and interleukin-4 (IL-4) cytokines in serum and mixed saliva in patients with uncomplicated mandibular fracture and post-traumatic osteomyelitis at the first and tenth days of observation. By means of single-layer neural networks, binary classifiers were built, allowing patients to be stratified by the clinical form of the disease and to predict its course. The probability of uncomplicated mandibular fracture is described by the ratio P = 1/(1+e-z), where the index z is determined by the level of TNFα, IL-17, and IL-4 at the first and tenth day of observation. The simulation confirmed high prognostic significance of serum TNFα and IL-17 for early verification of posttraumatic osteomyelitis, which was confirmed by the OTC and ROC indices, which varied from 87 to 100% in different models. Models 4 and 5, where TNFα recorded on the tenth day of the study was used as predictors, and a combination of TNFα and IL-17 obtained on the first day of hospitalization, were the most accurate. Modeling the results of the study of immunological indicators in the mixed saliva showed that the predictive properties have only IL-4 and IL-17, was on the tenth day of hospitalization that distinguishes these binary classifiers from similar indexes, derive from the levels of cytokines in blood serum. The results of the study indicate the important role of disorders in the system of рro- and anti-inflammatory cytokines in pathogenesis of post-traumatic osteomyelitis

ИССЛЕДОВАНИЕ И РАЗРАБОТКА МЕТОДА КОНТРОЛЯ ПАТОГЕННЫХ ПРИОННЫХ ИНФЕКЦИЙ ПОБОЧНОГО СЫРЬЯ МЯСНОЙ ПРОМЫШЛЕННОСТИ

Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries) revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail). The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left) and CAGTTTCGATCCTCCTCCAG (right) primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.Разработан высокочувствительный и специфичный метод идентификации патогенного прионного белка. Установлено, что фракции водорастворимых белков говядины и плазмы крови сельскохозяйственных животных являются нормальными прионными белками крупного рогатого скота. Выравнивание последовательностей гена  патогенного и нормального прионного белка Ovisaries, показало, что нуклеотидные последовательности PrPc и PrPsc являются идентичными. Выбрано мышиное моноклональное антитело 15В3. Построена синтетическая последовательность, дли-ной 194 п.н., полученная случайным образом (ДНК-хвост). Созданная последовательность и последовательности базы данных гомологов не имеют. К синтезированному ДНК-хвосту подобраны 2 праймера размерами 20 п.н. Полученныеэкспериментальные данные указывают на то, что при использовании праймеров AGTCAGTCCTTGGCCTCCTT (левого) и CAGTTTCGATCCTCCTCCAG (правого)  амплификацию следует проводить по следующей схеме: предварительная денатурация, 95 °С, 60 секунд, 1 цикл; денатурация, 95 °С, 30 секунд, 30 циклов; отжиг, 56 °С, 60 секунд, 30 циклов; элонгация, 72 °С, 30 секунд, 30 циклов,  дополнительная элонгация в течение 1 цикла продолжительностью 600 секунд.Установлена оптимальная концентрация компонентов реакционной смеси для проведения ПЦР. Подтверждена высокая специфичность разработанной тест-системы и олигонуклеотидных праймеров путем электрофоретического разделения образцов мясного фарша, содержащего патогенный прионный белок, а также путем  сравнительного анализа результатов определения патогенного прионного белка,полученных с помощью ПЦР-тест-системы и ИФА-системы «TeSeE™»

Two-Stage Treatment of Enterocutaneous Fistulas

Aim: to determine the most efficient treatment of enterocutaneous fistulas.Materials and methods. Eighty-eight patients with intestinal fistulas underwent a two-stage treatment, including: the first stage — multicomponent therapy, the second stage — reconstructive surgery. Enterocutaneous fistulas were diagnosed in 61 patients, enteroatmospheric fistulas — in 26 patients, and combined fistula (enterocutaneous and enteroatmospheric) — in 1 patient.Results. All 88 patients underwent reconstructive surgery after the multicomponent therapy. Resection of the intestine with a fistula with the formation of an entero-entero anastomosis was performed in 72 (81.8 %) patients; marginal resection of the intestine with a fistula, followed by suturing of the defect — in 7 (8.0 %); resection of the intestine with fistulas in combination with excision and suturing of the fistula — in 5 (5.7 %); an operation aimed at disabling the fistula from the passage of intestinal contents — in 3 (3.4 %); resection of the intestine with a fistula in combination with fistula exclusion — in 1 (1.1 %) patient. Postoperative complications in the group of patients with enteroatmospheric fistulas occurred in 13 cases, in the group with enterocutaneous fistulas — in 25 patients. Three (3.4 %) patients with enterocutaneous fistulas died from complications unrelated to the underlying disease and surgical interventions.Conclusion. Two-stage treatment including multicomponent therapy (nutritional support, infection generalization control, local wound treatment) and reconstructive surgery allowed to reduce mortality rates to 3.4 %, which proves the effectiveness of this method

Метастазы рака почки в поджелудочной железе: сравнительная эффективность хирургии и фармакотерапии

Background. Today, targeted therapy is a standard treatment in advanced renal cell carcinoma, while the surgical method plays the role of a possible approach in a select category of patients with solitary and single metastases.The study objective to compare the effectiveness of two alternative treatment approaches: the surgical method and modern pharmacotherapy in achieving long-term overall survival of patients with pancreatic metastases of renal cell carcinoma.Materials and methods. A retrospective two-center study was conducted. The cohort of surgical treatment included patients (n = 56) who underwent surgery for pancreatic metastases from renal cell carcinoma at the N.N. Blokhin National Medical Research Center of Oncology and A.V. Vishnevsky National Medical Research Center of Surgery in the period from 1990 to 2019. Operations were performed for all types of pancreatic lesions: synchronous/metachronous, solitary/single and multiple, isolated/combined with lesions of other organs. Postoperative mortality rate was 5 % (3 patients). The pharmacotherapy cohort (n = 28) included patients with potentially resectable pancreatic metastases from clear cell renal cell carcinoma who underwent targeted therapy. Survival was assessed using the Kaplan–Mayer method. The Mantel–Cox test was used to test null hypothesis.Results. The 5-year overall survival rate was 68 % in the surgery group compared to 35 % for the pharmacotherapy group. Median overall survival for surgical and non-surgical patients was 82 months and 43 months, respectively (p = 0.01). The advantage of the surgical method was also found in a subgroup survival analysis of patients with extrapancreatic disease (p = 0.037). In this case, the 5-year overall survival rate was 66 % in the surgery subgroup (n = 25) compared to 35 % for the pharmacotherapy subgroup (n = 24). Conclusion. Radical surgical treatment in comparison with modern pharmacotherapy allows to achieve significantly higher rates of overall survival in patients with pancreatic metastases of renal cell carcinoma and can be considered as a priority.Введение. На сегодняшний день общепринятым стандартом лечения распространенного светлоклеточного рака почки (РП) является таргетная терапия, тогда как хирургическому методу отводится роль возможной опции у выборочной категории больных с солитарными и единичными метастазами.Цель исследования – сравнить эффективность 2 конкурирующих альтернативных подходов: хирургического метода и современной фармакотерапии в достижении длительной общей выживаемости больных с метастазами РП в поджелудочной железе.Материалы и методы. Проведено ретроспективное двухцентровое исследование. В когорту хирургического лечения вошли 56 пациентов, перенесших операции на поджелудочной железе различного объема (от атипичной резекции до панкреатэктомии) по поводу метастазов РП в НМИЦ онкологии им. Н.Н. Блохина и НМИЦ хирургии им. А.В. Вишневского в период с 1990 по 2019 г. Вмешательства выполняли при всех типах поражения поджелудочной железы: синхронном/метахронном, солитарном/единичном и множественном, изолированном/сочетанном с поражением других органов. Послеоперационная летальность составила 5 % (n = 3). В группу фармакотерапии включены 28 пациентов с потенциально резектабельными изолированными и сочетанными метастазами светлоклеточного РП в поджелудочной железе, получавшие лекарственную терапию таргетными агентами. Выживаемость оценивали с помощью метода Каплана–Майера. Для проверки нулевых гипотез применяли тест Mantel–Cox. Статистическую значимость различий по качественным признакам между независимыми группами определяли с использованием χ2-критерия Пирсона, по количественным признакам – U-критерия Манна–Уитни.Результаты. Показатель 5-летней общей выживаемости в группе хирургического лечения составил 68 % с медианой 82 мес, тогда как в группе фармакотерапии – 35 % с медианой 43 мес (p = 0,01). Преимущество хирургического метода обнаружено также при подгрупповом анализе выживаемости пациентов с сочетанными метастазами. В этом случае показатель 5-летней общей выживаемости в подгруппе хирургического лечения (n = 25) составил 66 % с медианой 75 мес, а в подгруппе фармакотерапии (n = 24) – 35 % с медианой 39 мес (p = 0,037).Заключение. Радикальное хирургическое лечение по сравнению с современной фармакотерапией позволяет достичь достоверно более высоких показателей общей выживаемости у больных с панкреатическими метастазами РП и может рассматриваться в качестве приоритетного.       

Панкреатический свищ при проксимальной резекции поджелудочной железы: корреляция компьютерно-томографических и морфологических предикторов

Purpose: identification of the possibilities of computer tomography with contrast enhancement in evaluated of the degree of fibrosis and number of acinar structures in the pancreatic parenchyma at the preoperative period to predict the development of postoperative complications.Material and methods: In the department of abdominal surgery in 2016-2019, 196 pancreatoduodenal resections were performed. Retrospectively selected group of patients (49). Patients were divided into 2 groups according with the postoperative period. The postoperative period was uncomplicated in 41 (84%) cases. Сlinically significant pancreatic fistula was in 8 (16%) cases. According to preoperative computed tomography with contrast enhancement, we evaluated: the structure of the pancreas; the density of the pancreas in the native phase of the scan (HU), parenchyma accumulation coefficient; parenchyma accumulation coefficient in the venous phase; parenchyma accumulation coefficient in the excretory phase; coefficient of relative washout of contrast enhancement of parenchyma. According histological we evaluated the number of fibrosis and acinar, fat cells in the section pancreas.Results: "Soft" structure of the pancreas (r=0,747, p=0,000), parenchyma accumulation coefficient (r=0,631, p=0,000), the density of the pancreas in the native phase of the scan (r=0,568, p=0,000) positively correlated with complicated postoperative period and the number of acinar cells. Parenchyma accumulation coefficient in the excretory phase (r=0,562, p=0,000) positively correlated with the fibrosis pancreas and in the negatively correlated with the complicated postoperative period. The risk of developing pancreatic fistula is 3 times higher with values parenchyma accumulation coefficient greater than 1, sensitivity 75%, specificity 73%. The risk of developing pancreatic fistula is 3 times higher with values parenchyma accumulation coefficient in the excretory phase less than 0.45, sensitivity 75%, specificity 63%.Conclusions: computed tomography with contrast enhancement allows the structure pancreas, the number of fibrosis and acinar cell sat the preoperative period to pick out the high-risk patient group to the development of postoperative complications.Цель исследования: определить возможности компьютерной томографии с контрастным усилением в оценке степени фиброза и количества ацинарных структур в паренхиме поджелудочной железы для прогнозирования тяжелого течения послеоперационного периода при проксимальных резекциях поджелудочной железы.Материал и методы. В отделении абдоминальной хирургии в 2016–2019 гг. было выполнено 196 панкреатодуоденальных резекций. Ретроспективно было отобрано 49 пациентов. Пациенты были разделены на 2 группы в соответствии с течением послеоперационного периода. Послеоперационный период протекал гладко в 41 (84%) случае. Клинически значимый панкреатический свищ развился в 8 (16%) случаях. По данным дооперационной компьютерной томографии (КТ) с контрастным усилением оценивали структуру дистального отдела железы, плотность дистального отдела железы в нативную фазу сканирования (HU), коэффициент накопления контрастного вещества паренхимой (КН), коэффициент накопления контрастного препарата в венозную (КНвен.) и выделительную (КНвыдел.) фазы, коэффициент относительного вымывания контрастного вещества (L/E). Гистологически оценивали количество фиброза, жира и ацинарных клеток в срезе удаленной железы.Результаты. “Мягкая” структура поджелудочной железы (r = 0,747, p = 0,000), значения коэффициента КН (r = 0,631, p = 0,000), плотность дистального отдела железы в нативную фазу сканирования (r = 0,568, p = 0,000) положительно коррелировали с тяжелым течением послеоперационного периода и количеством ацинарных клеток. Значения коэффициента КНвыдел. положительно коррелировали с количеством фиброза (r = 0,562, p = 0,000) в железе и отрицательно с течением послеоперационного периода. Риск развития панкреатического свища в 3 раза выше при значениях КН больше 1, чувствительности 75%, специфичности 73%. Риск развития панкреатического свища в 3 раза выше при значениях КНвыдел. менее 0,45, чувствительности 75%, специфичности 63%.Заключение. КТ с контрастным усилением позволяет оценить структуру паренхимы железы, количество фиброза и ацинарных клеток на дооперационном этапе для выделения группы повышенного риска тяжелого течения послеоперационного периода

Clinical Guidelines of the Russian Society of Surgeons, the Russian Gastroenterological Association, the Association of Surgeons-Hepatologists and the Endoscopic Society “REndO” on Diagnostics and Treatment of Chronic Pancreatitis

Aim: to present modern methods of diagnosis and treatment of chronic pancreatitis for gastroenterologists, general practitioners and physicians.Chronic pancreatitis (CP) is a long-term inflammatory disease of the pancreas, manifested by irreversible morphological changes in the parenchyma and pancreatic ducts, which cause pain and/or persistent impairment of function. Current concept on the etiology of CP is reflected by the TIGAR-O classification. The criteria for establishing the diagnosis of CP include typical attacks of abdominal pain and/or clinical and laboratory signs of exocrine, endocrine insufficiency with the mandatory detection of characteristic morphological changes (calcifications in the parenchyma and pancreatic ductal stones, dilatation of the main pancreatic duct and its branches). CT, MRCP, and pancreatobiliary endosonography are recommended as the methods of choice to verify the diagnosis of CP. Conservative treatment of patients with CP is provided for symptom relief and prevention of complications. Individual cases with severe non-interactable abdominal pain, as well as a complicated course of the disease (development of ductal hypertension due to main pancreatic duct stones or strictures, obstructive jaundice caused by compression of the common bile duct, symptomatic postnecrotic cysts, portal hypertension due to compression of the portal vein or thrombosis of the splenic vein, persistent duodenal obstruction, pseudoaneurysm of the celiac trunk basin and the superior mesenteric artery) serve as an indication for endoscopic or surgical treatment. The Guidelines set out modern approaches to the diagnosis, conservative, endoscopic and surgical treatment of CP, and the prevention of its complications.Conclusion. The implementation of clinical guidelines can contribute to the timely diagnosis and improve the quality of medical care for patients with chronic pancreatitis

ЛУЧЕВАЯ ДИАГНОСТИКА ИНСУЛИНОМ И НЕЗИДИОБЛАСТОЗА ПРИ СИНДРОМЕ ОРГАНИЧЕСКОГО ГИПЕРИНСУЛИНИЗМА

Insulinoma is the most frequently seen functional pancreatic neuroendocrine tumor. Materials and Methods: We conducted a retrospective review of 42 patients with pancreatic neuroendocrine neoplasms diagnosed pathomorpgologically and treated at the A. V. Vishnevsky Institute of Surgery, between 2011 and 2015. Results: The sensitivity in the detection of insulinoma was as follows: ultrasound - 62%, CT - 82%, MRI - 87,5%, endoscopic ultrasound - 83,3%, intraoperative ultrasound - 94,8%. Conclusions: The presence of the tumor before the operation must be confirmed by at least 2 instrumental diagnostic methods. Nesidioblastosis be suspected when a negative search result insulinoma all methods, but the final verification of the disease is possible only at the morphological study.Инсулиномы - это наиболее распространенные функционирующие опухоли поджелудочной железы, которые являются причиной синдрома органического гиперинсулинизма. Ретроспективно проанализированы результаты обследования 42 пациентов с гистологически подтвержденными нейроэндокринными неоплазиями поджелудочной железы, находившихся на лечении в нашем Институт хирургии им. А. В. Вишневского в период с 2011 по 2015 г. Протоколы дооперационных исследований мультиспиральной компьютерной томографии (МСКТ), магнитно-резонансной томографии (МРТ), ультразвукового исследования (УЗИ), эндоскопического ультразвукового исследования (эндо-УЗИ) сопоставлены с интраоперационными данными и результатами морфологического заключения. Чувствительность в выявлении инсулином составила: УЗИ - 62%, МСКТ - 82%, МРТ - 87,5%, эндо-УЗИ - 83,3%, ИОУЗИ - 94,8%. Наличие опухоли перед операцией должно быть подтверждено не менее чем двумя методами инструментальной диагностики. Незидиобластоз можно заподозрить при отрицательном результате поиска инсулиномы всеми методами лучевой диагностики, однако окончательная верификация этого заболевания возможна только при морфологическом исследовании