Strongly nonlinear dynamics of electrolytes in large ac voltages

We study the response of a model micro-electrochemical cell to a large ac voltage of frequency comparable to the inverse cell relaxation time. To bring out the basic physics, we consider the simplest possible model of a symmetric binary electrolyte confined between parallel-plate blocking electrodes, ignoring any transverse instability or fluid flow. We analyze the resulting one-dimensional problem by matched asymptotic expansions in the limit of thin double layers and extend previous work into the strongly nonlinear regime, which is characterized by two novel features - significant salt depletion in the electrolyte near the electrodes and, at very large voltage, the breakdown of the quasi-equilibrium structure of the double layers. The former leads to the prediction of "ac capacitive desalination", since there is a time-averaged transfer of salt from the bulk to the double layers, via oscillating diffusion layers. The latter is associated with transient diffusion limitation, which drives the formation and collapse of space-charge layers, even in the absence of any net Faradaic current through the cell. We also predict that steric effects of finite ion sizes (going beyond dilute solution theory) act to suppress the strongly nonlinear regime in the limit of concentrated electrolytes, ionic liquids and molten salts. Beyond the model problem, our reduced equations for thin double layers, based on uniformly valid matched asymptotic expansions, provide a useful mathematical framework to describe additional nonlinear responses to large ac voltages, such as Faradaic reactions, electro-osmotic instabilities, and induced-charge electrokinetic phenomena.Comment: 30 pages, 17 eps-figures, RevTe

Novel Scintillation Material - ZnO Transparent Ceramics

ZnO-based scintillation ceramics for application in HENPA LENPA analyzers have been investigated. The following ceramic samples have been prepared: undoped ones (ZnO), an excess of zinc in stoichiometry (ZnO:Zn), doped with gallium (ZnO:Ga) and lithium (ZnO:Li). Optical transmission, x-ray excited emission, scintillation decay and pulse height spectra were measured and analyzed. Ceramics have reasonable transparency in visible range (up to 60% for 0.4 mm thickness) and energy resolution (14.9% at 662 keV Cs137 gamma excitation). Undoped ZnO shows slow (1.6 {\mu}s) luminescence with maximum at 2.37 eV and light yield about 57% of CsI:Tl. ZnO:Ga ceramics show relatively low light yield with ultra fast decay time (1 ns). Lithium doped ceramics ZnO:Li have better decay time than undoped ZnO with fair light yield. ZnO:Li ceramics show good characteristics under alpha-particle excitation and can be applied for the neutral particle analyzers.Comment: 4 pages, 8 figures, research covered in this paper was presented at SCINT2011 conference as a poster, submitted for publication at IEEE Trans. Nucl. Sc

Influence of intermartensitic transitions on transport properties of Ni2.16Mn0.84Ga alloy

Magnetic, transport, and x-ray diffraction measurements of ferromagnetic shape memory alloy Ni$_{2.16}$Mn$_{0.84}$Ga revealed that this alloy undergoes an intermartensitic transition upon cooling, whereas no such a transition is observed upon subsequent heating. The difference in the modulation of the martensite forming upon cooling from the high-temperature austenitic state [5-layered (5M) martensite], and the martensite forming upon the intermartensitic transition [7-layered (7M) martensite] strongly affects the magnetic and transport properties of the alloy and results in a large thermal hysteresis of the resistivity $\rho$ and magnetization $M$. The intermartensitic transition has an especially marked influence on the transport properties, as is evident from a large difference in the resistivity of the 5M and 7M martensite, $(\rho_{\mathrm{5M}} - \rho_{\mathrm{7M}})/\rho _{\mathrm{5M}} \approx 15$, which is larger than the jump of resistivity at the martensitic transition from the cubic austenitic phase to the monoclinic 5M martensitic phase. We assume that this significant difference in $\rho$ between the martensitic phases is accounted for by nesting features of the Fermi surface. It is also suggested that the nesting hypothesis can explain the uncommon behavior of the resistivity at the martensitic transition, observed in stoichiometric and near-stoichiometric Ni-Mn-Ga alloys.Comment: 7 pages, 6 figures, REVTEX

Formation of memristor structures based on ZnO thin films by scratching probe nanolithography

This work was supported by Grant of the President of the Russian Federation No. MK-2721.2018.8. and by RFBR according to the research project № 18-37-0029

Mechanisms of Manganese-Assisted Nonradiative Recombination in Cd(Mn)Se/Zn(Mn)Se Quantum Dots

Mechanisms of nonradiative recombination of electron-hole complexes in Cd(Mn)Se/Zn(Mn)Se quantum dots accompanied by interconfigurational excitations of Mn$^{2+}$ ions are analyzed within the framework of single electron model of deep {\it 3d}-levels in semiconductors. In addition to the mechanisms caused by Coulomb and exchange interactions, which are related because of the Pauli principle, another mechanism due to {\it sp-d} mixing is considered. It is shown that the Coulomb mechanism reduces to long-range dipole-dipole energy transfer from photoexcited quantum dots to Mn$^{2+}$ ions. The recombination due to the Coulomb mechanism is allowed for any states of Mn$^{2+}$ ions and {\it e-h} complexes. In contrast, short-range exchange and ${\it sp-d}$ recombinations are subject to spin selection rules, which are the result of strong {\it lh-hh} splitting of hole states in quantum dots. Estimates show that efficiency of the {\it sp-d} mechanism can considerably exceed that of the Coulomb mechanism. The phonon-assisted recombination and processes involving upper excited states of Mn$^{2+}$ ions are studied. The increase in PL intensity of an ensemble of quantum dots in a magnetic field perpendicular to the sample growth plane observed earlier is analyzed as a possible manifestation of the spin-dependent recombination.Comment: 14 pages, 2 figure

PROSPECTS AND RESULTS OF STUDYING THE COLLECTION OF CHICKPEA FROM VIR AT OMSK STATE AGRARIAN UNIVERSITY

In 2012-1016, 23 chickpea accessions from VIR and 23 accessions from the collection of chickpea somaclones of the Siberian Research Institute of Forages were studied at Omsk State Agrarian University. The research performed in the southern forest-steppe of West Siberia resulted in identifying chickpea accessions with a shorter growing season, high plant productivity, good processability, and high symbiotic activity. The possibility of using cluster analysis for comprehensive assessment of source material for chickpea breeding was demonstrated. The nature of inheritance of agronomic traits in F1 chickpea hybrids was revealed, and recommendations for selection were formulated. A correlation was established between the major characters

Formation of social and occupational youth mobility in project activities

The article introduces an experience of forming social and occupational mobility of students at pedagogical University during the project activityРассматривается опыт формирования социально-профессиональной мобильности студентов педагогического вуза в процессе проектной деятельност

Гістерезис електричного опору платинової нитки в холодних воднево-повітряних сумішах

Ignition of gaseous combustible mixtures on catalytically active hot solid surfaces has numerous applications in many industrial processes and is a complex process that involves close interaction between surface processes and transfer processes in the gas mixture. In this paper, stable and critical states catalytic oxidation of hydrogen impurities in air on a platinum filament are considered. It is shown that filament temperature and its resistance depending on the mixture temperature and hydrogen concentration are of the hysteresis features. Within this hysteresis region, it is possible to achieve the catalytic combustion mode of hydrogen as a result preheating the catalyst filament above a certain critical value. The dependence of the limiting hydrogen's concentration on catalyst filament's diameter, above which is observed in the cold gas mixture self-sustaining catalytic combustion without electric current.Займання газоподібних горючих сумішей на каталітично активних гарячих твердих поверхнях має численні застосування в багатьох промислових процесах і являє собою складний процес, що має на увазі тісну взаємодію між поверхневими процесами і процесами перенесення в газовій суміші. У даній роботі розглядаються стійкі і критичні стани каталітичного окислення домішки водню в повітрі на платиновій нитці. Показано, що температура нитки та її опір в залежності від температури навколишньої суміші і концентрації водню мають гістерезисний характер. Усередині даної гістерезисної області можливе досягнення режиму каталітичного горіння водню в результаті попереднього нагрівання нитки каталізатора вище певного критичного значення. Отримана залежність граничної концентрації водню від діаметра нитки каталізатора, вище якої спостерігається в холодній газовій суміші самопідтримується каталітичне горіння без протікання електричного струму

Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer