810 research outputs found
Strongly nonlinear dynamics of electrolytes in large ac voltages
We study the response of a model micro-electrochemical cell to a large ac
voltage of frequency comparable to the inverse cell relaxation time. To bring
out the basic physics, we consider the simplest possible model of a symmetric
binary electrolyte confined between parallel-plate blocking electrodes,
ignoring any transverse instability or fluid flow. We analyze the resulting
one-dimensional problem by matched asymptotic expansions in the limit of thin
double layers and extend previous work into the strongly nonlinear regime,
which is characterized by two novel features - significant salt depletion in
the electrolyte near the electrodes and, at very large voltage, the breakdown
of the quasi-equilibrium structure of the double layers. The former leads to
the prediction of "ac capacitive desalination", since there is a time-averaged
transfer of salt from the bulk to the double layers, via oscillating diffusion
layers. The latter is associated with transient diffusion limitation, which
drives the formation and collapse of space-charge layers, even in the absence
of any net Faradaic current through the cell. We also predict that steric
effects of finite ion sizes (going beyond dilute solution theory) act to
suppress the strongly nonlinear regime in the limit of concentrated
electrolytes, ionic liquids and molten salts. Beyond the model problem, our
reduced equations for thin double layers, based on uniformly valid matched
asymptotic expansions, provide a useful mathematical framework to describe
additional nonlinear responses to large ac voltages, such as Faradaic
reactions, electro-osmotic instabilities, and induced-charge electrokinetic
phenomena.Comment: 30 pages, 17 eps-figures, RevTe
Novel Scintillation Material - ZnO Transparent Ceramics
ZnO-based scintillation ceramics for application in HENPA LENPA analyzers
have been investigated. The following ceramic samples have been prepared:
undoped ones (ZnO), an excess of zinc in stoichiometry (ZnO:Zn), doped with
gallium (ZnO:Ga) and lithium (ZnO:Li). Optical transmission, x-ray excited
emission, scintillation decay and pulse height spectra were measured and
analyzed. Ceramics have reasonable transparency in visible range (up to 60% for
0.4 mm thickness) and energy resolution (14.9% at 662 keV Cs137 gamma
excitation). Undoped ZnO shows slow (1.6 {\mu}s) luminescence with maximum at
2.37 eV and light yield about 57% of CsI:Tl. ZnO:Ga ceramics show relatively
low light yield with ultra fast decay time (1 ns). Lithium doped ceramics
ZnO:Li have better decay time than undoped ZnO with fair light yield. ZnO:Li
ceramics show good characteristics under alpha-particle excitation and can be
applied for the neutral particle analyzers.Comment: 4 pages, 8 figures, research covered in this paper was presented at
SCINT2011 conference as a poster, submitted for publication at IEEE Trans.
Nucl. Sc
Influence of intermartensitic transitions on transport properties of Ni2.16Mn0.84Ga alloy
Magnetic, transport, and x-ray diffraction measurements of ferromagnetic
shape memory alloy NiMnGa revealed that this alloy undergoes
an intermartensitic transition upon cooling, whereas no such a transition is
observed upon subsequent heating. The difference in the modulation of the
martensite forming upon cooling from the high-temperature austenitic state
[5-layered (5M) martensite], and the martensite forming upon the
intermartensitic transition [7-layered (7M) martensite] strongly affects the
magnetic and transport properties of the alloy and results in a large thermal
hysteresis of the resistivity and magnetization . The
intermartensitic transition has an especially marked influence on the transport
properties, as is evident from a large difference in the resistivity of the 5M
and 7M martensite, , which is larger than the jump of resistivity at
the martensitic transition from the cubic austenitic phase to the monoclinic 5M
martensitic phase. We assume that this significant difference in between
the martensitic phases is accounted for by nesting features of the Fermi
surface. It is also suggested that the nesting hypothesis can explain the
uncommon behavior of the resistivity at the martensitic transition, observed in
stoichiometric and near-stoichiometric Ni-Mn-Ga alloys.Comment: 7 pages, 6 figures, REVTEX
Formation of memristor structures based on ZnO thin films by scratching probe nanolithography
This work was supported by Grant of the President of the Russian Federation No. MK-2721.2018.8. and by RFBR according to the research project № 18-37-0029
Mechanisms of Manganese-Assisted Nonradiative Recombination in Cd(Mn)Se/Zn(Mn)Se Quantum Dots
Mechanisms of nonradiative recombination of electron-hole complexes in
Cd(Mn)Se/Zn(Mn)Se quantum dots accompanied by interconfigurational excitations
of Mn ions are analyzed within the framework of single electron model of
deep {\it 3d}-levels in semiconductors. In addition to the mechanisms caused by
Coulomb and exchange interactions, which are related because of the Pauli
principle, another mechanism due to {\it sp-d} mixing is considered. It is
shown that the Coulomb mechanism reduces to long-range dipole-dipole energy
transfer from photoexcited quantum dots to Mn ions. The recombination
due to the Coulomb mechanism is allowed for any states of Mn ions and
{\it e-h} complexes. In contrast, short-range exchange and
recombinations are subject to spin selection rules, which are the result of
strong {\it lh-hh} splitting of hole states in quantum dots. Estimates show
that efficiency of the {\it sp-d} mechanism can considerably exceed that of the
Coulomb mechanism. The phonon-assisted recombination and processes involving
upper excited states of Mn ions are studied. The increase in PL
intensity of an ensemble of quantum dots in a magnetic field perpendicular to
the sample growth plane observed earlier is analyzed as a possible
manifestation of the spin-dependent recombination.Comment: 14 pages, 2 figure
PROSPECTS AND RESULTS OF STUDYING THE COLLECTION OF CHICKPEA FROM VIR AT OMSK STATE AGRARIAN UNIVERSITY
In 2012-1016, 23 chickpea accessions from VIR and 23 accessions from the collection of chickpea somaclones of the Siberian Research Institute of Forages were studied at Omsk State Agrarian University. The research performed in the southern forest-steppe of West Siberia resulted in identifying chickpea accessions with a shorter growing season, high plant productivity, good processability, and high symbiotic activity. The possibility of using cluster analysis for comprehensive assessment of source material for chickpea breeding was demonstrated. The nature of inheritance of agronomic traits in F1 chickpea hybrids was revealed, and recommendations for selection were formulated. A correlation was established between the major characters
Formation of social and occupational youth mobility in project activities
The article introduces an experience of forming social and occupational mobility of students at pedagogical University during the project activityРассматривается опыт формирования социально-профессиональной мобильности студентов педагогического вуза в процессе проектной деятельност
Гістерезис електричного опору платинової нитки в холодних воднево-повітряних сумішах
Ignition of gaseous combustible mixtures on catalytically active hot solid surfaces has numerous applications in many industrial processes and is a complex process that involves close interaction between surface processes and transfer processes in the gas mixture. In this paper, stable and critical states catalytic oxidation of hydrogen impurities in air on a platinum filament are considered. It is shown that filament temperature and its resistance depending on the mixture temperature and hydrogen concentration are of the hysteresis features. Within this hysteresis region, it is possible to achieve the catalytic combustion mode of hydrogen as a result preheating the catalyst filament above a certain critical value. The dependence of the limiting hydrogen's concentration on catalyst filament's diameter, above which is observed in the cold gas mixture self-sustaining catalytic combustion without electric current.Займання газоподібних горючих сумішей на каталітично активних гарячих твердих поверхнях має численні застосування в багатьох промислових процесах і являє собою складний процес, що має на увазі тісну взаємодію між поверхневими процесами і процесами перенесення в газовій суміші. У даній роботі розглядаються стійкі і критичні стани каталітичного окислення домішки водню в повітрі на платиновій нитці. Показано, що температура нитки та її опір в залежності від температури навколишньої суміші і концентрації водню мають гістерезисний характер. Усередині даної гістерезисної області можливе досягнення режиму каталітичного горіння водню в результаті попереднього нагрівання нитки каталізатора вище певного критичного значення. Отримана залежність граничної концентрації водню від діаметра нитки каталізатора, вище якої спостерігається в холодній газовій суміші самопідтримується каталітичне горіння без протікання електричного струму
Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification
Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II) and Al(III) were active as photosensitizers in the generation of singlet oxygen (1)O(2), while phthalocyanine of Co(II) promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ((.)O(2)(−), H(2)O(2), OH). Irradiation of the reaction mixture containing either Zn(II)- or Al(III)-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA) with light of > 340 nm wavelength (Hg lamp or He/Ne laser) resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT). A conjugate of Co(II)-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O(2) and 2-mercaptoethanol or in the presence of H(2)O(2). Under both sensitized and catalyzed conditions, the nucleotides G(13)–G(15) were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer
- …