Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

<p>Abstract</p> <p>Background</p> <p>Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine <it>PRNP</it> (b<it>PRNP</it>) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down b<it>PRNP</it> were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of <it>PRNP</it>, and lengths of siRNAs.</p> <p>Results</p> <p>Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNA^Valpromoter. Six target sites of bovine <it>PRNP </it>were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire b<it>PRNP </it>coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or <it>Renilla </it>luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a <it>Bsp </it>MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.</p> <p>Conclusion</p> <p>Four siRNA expression plasmid vectors, six target sites of b<it>PRNP</it>, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of b<it>PRNP </it>in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.</p

Two types of martensitic phase transformations in magnetic shape memory alloys by in-situ nanoindentation studies

Ni based magnetic shape memory alloys (MSMAs) have broad applications in actuators and MEMS devices. Two-stage stress induced martensitic phase transformation, a widely observed phenomenon in these alloys, is described conventionally as a first stage L21 (austenite)-to-10M/14M (M: modulated martensite) transition, followed by a second stage 14M-to-L10 (tetragonal martensite) transformation at higher stresses. Here we show, for the first time via in-situ nanoindentation on single crystalline Ni54Fe19Ga27 alloy, that a reversible L21-to-10M/14M transformations took place at lower stress. However at higher stress, an irreversible transition from residual L21 to L10 martensite (a second type of phase transformation) occurred. Furthermore phase fronts propagate gradually during the L21-to-10M/14M transformation, whereas L10 is abruptly emitted in a jerky style during the 14M-to-L10 transformation. Detailed examination of crystal structure suggests that a direct transition from 14M to observed L10 is crystallographically forbidden in the current loading condition. This study provides new perspective for understanding of stress induced various types of phase transformations in MSMAs. This research is funded by NSF-CMMI under grant no. 1129065