Studying pauses and pulses in human mobility and their environmental impacts

Funding: This article is a contribution of the COVID-19 Bio-Logging Initiative, which is funded in part by the Gordon and Betty Moore Foundation (GBMF9881; Lead-PI: C.R.) and the National Geographic Society (NGS-82515R-20; PI: C.R.), and endorsed by the United Nations Decade of Ocean Science for Sustainable Development.PostprintPeer reviewe

New Caledonian crows afford invaluable comparative insights into human cumulative technological culture

The New Caledonian crow may be the only non-primate species exhibiting cumulative technological culture. Its foraging tools show clear signs of diversification and progressive refinement, and it seems likely that at least some tool-related information is passed across generations via social learning. Here, we explain how these remarkable birds can help us uncover the basic biological processes driving technological progress.PostprintPeer reviewe

Behavioural plasticity compensates for adaptive loss of cricket song

Funding: Funding was provided by UK Natural Environment Research Council grants to N.W.B. (NE/L011255/1, NE/T000619/1) and a University of St Andrews School of Biology PhD studentship to W.T.S.Behavioural flexibility might help animals cope with costs of genetic variants under selection, promoting genetic adaptation. However, it has proven challenging to experimentally link behavioural flexibility to the predicted compensation of population-level fitness. We tested this prediction using the field cricket Teleogryllus oceanicus. In Hawaiian populations, a mutation silences males and protects against eavesdropping parasitoids. To examine how the loss of this critical acoustic communication signal impacts offspring production and mate location, we developed a high- resolution, individual-based tracking system for low-light, naturalistic conditions. Offspring production did not differ significantly in replicate silent versus singing populations, and fitness compensation in silent conditions was associated with significantly increased locomotion in both sexes. Our results provide evidence that flexible behaviour can promote genetic adaptation via compensation in reproductive output and suggest that rapid evolution of animal communication systems may be less constrained than previously appreciated.Peer reviewe

New Caledonian crows keep 'valuable' hooked tools safer than basic non-hooked tools

Funding: This study was funded through a BBSRC David Phillips Fellowship (BB/G023913/1 and /2 to CR) and a PhD studentship from the BBSRC and the University of St Andrews (to BCK). During the final stages of manuscript preparation, CR was the grateful recipient of a Radcliffe Fellowship at the Radcliffe Institute for Advanced Study, Harvard University, and a BBSRC grant (BB/S018484/1).The temporary storage and re-use of tools can significantly enhance foraging efficiency. New Caledonian crows in one of our study populations use two types of stick tools – hooked and non-hooked – which differ in raw material, manufacture costs, and foraging performance. Using a large sample of wild-caught, temporarily captive New Caledonian crows, we investigated experimentally whether individuals prefer one tool type over the other when given a choice and whether they take better care of their preferred tools between successive episodes of use, safely storing them underfoot or in nearby holes. Crows strongly preferred hooked stick tools made from Desmanthus virgatus stems over non-hooked stick tools. Importantly, this preference was also reflected in subsequent tool-handling behaviour, with subjects keeping hooked stick tools safe more often than non-hooked stick tools sourced from leaf litter. These results suggest that crows ‘value’ hooked stick tools, which are both costlier to procure and more efficient to use, more than non-hooked stick tools. Results from a series of control treatments suggested that crows altered their tool ‘safekeeping’ behaviour in response to a combination of factors, including tool type and raw material. To our knowledge, our study is the first to use safekeeping behaviour as a proxy for assessing how non-human animals value different tool types, establishing a novel paradigm for productive cross-taxonomic comparisons.Publisher PDFPeer reviewe

Strong between-site variation in New Caledonian crows' use of hook-tool-making materials

The study was funded through a BBSRC David Phillips Fellowship (grants BB/G023913/1 and BB/G023913/2 to CR) and doctoral studentships from the BBSRC (BK), JASSO (SS), and the School of Biology, University of St Andrews (JvdW).Functional tool use requires the selection of appropriate raw materials. New Caledonian crows Corvus moneduloides are known for their extraordinary tool-making behaviour, including the crafting of hooked stick tools from branched vegetation. We describe a surprisingly strong between-site difference in the plant materials used by wild crows to manufacture these tools: crows at one study site use branches of the non-native shrub Desmanthus virgatus, whereas only approximately 7 km away, birds apparently ignore this material in favour of the terminal twigs of an as-yet-unidentified tree species. Although it is likely that differences in local plant communities drive this striking pattern, it remains to be determined how and why crows develop such strong site-specific preferences for certain raw materials.Publisher PDFPeer reviewe

Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.

The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation

The cAMP effector EPAC activates Elk1 transcription factor in prostate smooth muscle, and is a minor regulator of alpha 1-adrenergic contraction

Background: Prostate smooth muscle tone is regulated by alpha 1-adrenoceptor-induced contraction and cAMP-mediated relaxation. EPAC is an effector of cAMP, being involved in smooth muscle relaxation and cell cycle control outside the lower urinary tract. Here, we investigated the expression and function of EPAC in human prostate tissues from patients undergoing radical prostatectomy. Results: mRNA and protein expression of EPAC was detected in all prostate tissues by RT-PCR and Western blot analysis. Immunoreactivity was observed in stromal cells, and colocalized with immunofluorescence for a-smooth muscle actin and calponin. Under normal conditions, noradrenaline-or phenylephrine-induced contraction of prostate strips in the organ bath was not affected by the EPAC activator pCPT (SP-8-pCPT-2'-O-Me-cAMPS.NA) (30 mu M). However, when the cyclooxygenase inhibitor indomethacin (50 mu M) was added, EPAC activators pCPT and OME (8-CPT-2'-O-Me-cAMP.Na) (30 mu M) significantly reduced contractions by low concentrations of phenylephrine. These effects were not observed on noradrenaline-induced contraction. OME and pCPT caused phosphorylation of the transcription factor Elk1 in prostate tissues. Elk1 activation was confirmed by EMSA (electrophoretic mobility shift assay), where OME and pCPT incresed Elk1 binding to a specific DNA probe. Conclusions: EPAC activation may reduce alpha 1-adrenergic prostate contraction in the human prostate, although this effect is masked by cyclooxygenases and beta-adrenoceptors. A main EPAC function in the human prostate may be the regulation of the transcription factor Elk1

Fitness benefits of alternated chick provisioning in cooperatively breeding carrion crows

This work was funded by the Spanish Ministerio de Economía y Competitividad (Grant CGL2016 – 77636-P to VB) and a SEO-Birdlife Research Grant (to ET). Contributions to the writing were covered in part by the Biotechnology and Biological Sciences Research Council (BBSRC; Grant BB/S018484/1 to CR).1. In most bird species, parents raise offspring cooperatively. In some cases, this cooperation extends to helpers-at-the-nest who assist the breeders with a range of tasks. 2. While cooperative food provisioning might merely arise incidentally, as a result of the efforts of carers that act independently from each other, recent studies suggest that birds may coordinate by taking turns in visiting the nest. However, evidence that such coordination emerges because individuals actively respond to each other's behaviour is controversial, and the potential benefits of carers' alternation remain unknown. 3. We addressed this knowledge gap by analysing a multiyear dataset for cooperatively breeding carrion crows Corvus corone, comprising 8693 nest visits across 50 groups. 4. Our results reveal that turn-taking does occur in this species and that all group members, regardless of their sex and social role (breeder/helper), tend to alternate at the nest with other carers rather than to make repeat visits. 5. Importantly, we found that the body mass of nestlings increased significantly with the degree of carers' alternation, possibly because well-coordinated groups provided food at more regular intervals. 6. Using earlier monitoring data, the observed increase in body mass is predicted to substantially boost postfledging survival rates. Our analyses demonstrate that alternation in nestling provisioning has measurable fitness benefits in this study system. 7. This raises the possibility that cooperatively breeding carrion crows, as well as other bird species with similarly coordinated brood provisioning, exhibit specialized behavioural strategies that enable effective alternation.PostprintPeer reviewe

Global COVID-19 lockdown highlights humans as both threats and custodians of the environment

Funding: Gordon and Betty Moore Foundation; National Geographic Society (NGS-82515R-20).The global lockdown to mitigate COVID-19 pandemic health risks has altered human interactions with nature. Here, we report immediate impacts of changes in human activities on wildlife and environmental threats during the early lockdown months of 2020, based on 877 qualitative reports and 332 quantitative assessments from 89 different studies. Hundreds of reports of unusual species observations from around the world suggest that animals quickly responded to the reductions in human presence. However, negative effects of lockdown on conservation also emerged, as confinement resulted in some park officials being unable to perform conservation, restoration and enforcement tasks, resulting in local increases in illegal activities such as hunting. Overall, there is a complex mixture of positive and negative effects of the pandemic lockdown on nature, all of which have the potential to lead to cascading responses which in turn impact wildlife and nature conservation. While the net effect of the lockdown will need to be assessed over years as data becomes available and persistent effects emerge, immediate responses were detected across the world. Thus initial qualitative and quantitative data arising from this serendipitous global quasi-experimental perturbation highlights the dual role that humans play in threatening and protecting species and ecosystems. Pathways to favorably tilt this delicate balance include reducing impacts and increasing conservation effectiveness.PostprintPeer reviewe

Examining the mechanisms underlying the acquisition of animal tool behaviour

Funding: The project STONECULT was funded by the European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation programme (grant agreement no. 714658). E.B. and C.T. are supported by the Institutional Strategy of the University of Tübingen (Deutsche Forschungsgemeinschaft, ZUK 63). M.P.S.is supported by the University of St Andrews through a School of Biology Postgraduate Scholarship, and C.R. contributed to this piece while he was the grateful recipient of a Radcliffe Fellowship at the Radcliffe Institute for Advanced Study, Harvard University.Despite major advances in the study of animal tool behaviour, researchers continue to debate how exactly certain behaviours are acquired. While specific mechanisms, such as genetic predispositions or action copying, are sometimes suspected to play a major role in behavioural acquisition, controlled experiments are required to provide conclusive evidence. In this opinion piece, we refer to classic ethological methodologies to emphasize the need for studying the relative contributions of different factors to the emergence of specific tool behaviours. We describe a methodology, consisting of a carefully staged series of baseline and social-learning conditions, that enables us to tease apart the roles of different mechanisms in the development of behavioural repertoires. Experiments employing our proposed methodology will not only advance our understanding of animal learning and culture, but as a result, will also help inform hypotheses about human cognitive, cultural and technological evolution. More generally, our conceptual framework is suitable for guiding the detailed investigation of other seemingly complex animal behaviours.Publisher PDFPeer reviewe