9 research outputs found

    PENINGKATAN TNF-α DAN INDEKS APOPTOSIS PADA TULANG MENCIT YANG DIINFEKSI Toxoplasma gondii

    Get PDF
    Penelitian ini bertujuan mengetahui peningkatan tumor necrosis factor-alpha (TNF-α) dan indeks apoptosis pada tulang mencit yang  diinfeksi Toxoplasma gondii (T. gondii). Tiga puluh dua ekor mencit dibagi menjadi dua kelompok. Kelompok 1 (K1), merupakan kelompok kontrol, tidak diinfeksi sedangkan Kelompok 2 (K2) diinfeksi dengan 10 takizoit T. gondii secara intraperitoneal. Enam hari setelah infeksi mencit dikorbankan, diambil tulang femur dan dilakukan pembuatan preparat histologis dengan pengecatan immunohistochemistry (IHC) dan Tunel assay. Hasil penelitian menunjukkan jumlah sel tulang yang mengekspresikan TNF-α pada K2 (27,04±6,92) berbeda sangat nyata dibandingkan dengan K1 (11,42±3,92). Indeks apoptosis pada K1 dan K2 masing-masing adalah 9,17±3,04 dan 16,28±3,37. Dari hasil penelitian disimpulkan bahwa infeksi T. gondii meningkatkan TNF-α dan indeks apoptosis sel tulang femur

    Opportunistic parasitic infections in patients with human immunodeficiency virus/acquired immunodeficiency syndrome: A review

    Get PDF
    The number of human immunodeficiency virus (HIV) cases increases annually, and Indonesia has become the country with the fastest HIV/acquired immunodeficiency syndrome (AIDS) epidemic spread among the five Southeast Asian countries. Indonesia entered the critical phase of HIV/AIDS infections after 5 out of the 33 provinces, namely, Papua, Jakarta, Bali, West Java, and East Java, reported HIV/AIDS epidemic since 2004. In AIDS pathophysiology and immune-suppression are severe, thus, opportunistic intestinal parasitic infections that cause diarrhea in HIV infection may be fatal. Several studies have suggested that Cryptosporidium parvum, Isospora belli, and Blastocystis hominis are the most common intestinal protozoan parasites categorized as AIDS associated illness. Diarrhea caused by parasites is considerably suspected in the cases of chronic and persistent diarrhea in adults, in an era of increasing HIV/AIDS cases nowadays. The present review highlights the current advances in etiologic agents of HIV/AIDS opportunistic infections among countries, epidemiology and prevalence, lifecycle, risk factors, examination methods, and treatment. Keywords: epidemic, immune suppression, opportunistic infection, protozo

    Prevalensi dan Tingkat Kelulushidupan Ikan Mas (Cyprinus Carpio) yang Diuji Tantang dengan Protein Spora Utuh Myxobolus Koi di Tambak [ Prevalence And The Survival Rate Of Gold Fish (Cyprinus Carpio Linn) That Challenced Whole Protein Spore Myxobolus Koi In Pond]

    Full text link
    One of parasite disease that often outbreak is protozoan disease that caused by Myxobollus koi, that recaqniced Myxobolusis. Starting at 2009 this disease included in fish quarantine disease, because it can caused fish sick and dead. This disease can to be big problem in aquaculture, it can caused mortality 60-90%, with the prevalence reach 100%. In 1974 and 1978 the myxobolusis case happened in Indonesia and it caused mortality antil 100% in seed stadium. The aims of this Research are to detect the prevalence of the gold fish (Cyprinus carpio Linn) that infected by Myxobolus koi that challence by spora protein of Myxobolus koi in pond and want know abaout the survival rate of gold fish (Cyprinus carpio Linn) that challence by protein spora of Myxobolus koi in pond. This Research is field experiment that consist to 4 group, this are : KP1= Controle (No challence by protein spore and nor infected by Myxobolus koi) ; KP2 = challence by protein spore and infected by the dose 600 µl/l/one fish and infeted by Myxobolus koi dengan with dose 80 spore / liter, KP3 = No challence by Protein spore with dose 600 µl/l/one fish and was infected by Myxobolus koi with dose 80 spore / liter and KP4 = challence with Protein spore and not infcteted by Myxobolus koi. The result showed that the highest prevalence 74% found on gold fish that infected by Myxobolus koi and not dipping by whole protein spore before scatter in pond and in 60 days age. Whole Protein spore of Myxobolus koi can be decreased the prevalence of the gold fish (Cyprinus carpio Linn) infected by Myxobolus koi in pond 47,8% for 30 days age, 62,1% for 60 days and 69% for 90 days age in pond. The Whole Protein spore of Myxobolus koi also can increased the survival rate of gold fish (Cyprinus carpio Linn) in pond from 29% to 81%, it means that whole protein spore can increased in 179,3%

    Use of Disinfection Chamber to Prevent Covid-19 at the Faculty of Veterinary Medicine, Universitas Airlangga

    Full text link
    Community empowerment at the Faculty of Veterinary Medicine and Animal Education Hospital (RSHP) Universitas Airlangga aimed to prevent Covid-19 among students, picket workers, employees, veterinarians, nurses, and the client who bring animals to RSHP. The program starts from observation to implementation in May-October 2020. Implementation of community empowerment program in collaboration with the KKN program in Surabaya. This program introduced the disinfection chamber model of an automatic sprayer that is safe for health and complies with the standard operating procedure (SOP) for the use of the disinfection chamber. The existence of a disinfection chamber at the entrance to the campus and RSHP has contributed a lot to prevent the spread of Covid-19. The post-test results showed an increase in public understanding of the existence of disinfection chamber as a way to reduce the spread of Covid-19 and implement health protocols and healthy lifestyles

    Analisis Respons Imun Ikan Koi (Cyprinus Carpio Koi) Yang Divaksin Dengan Whole Protein Spora Myxobolus Koi Sebagai Kandidat Vaksin Myxobolusis [ Immune Response Analysis of Fish Koi (Cyprinus Carpio Koi) Vaccinated Myxobolus Koi Spores Whole Protein as Vaccine Candidate Myxobolusis]

    Full text link
    Myxobolus is one of parasites on koi fish that belongs to a class myxosporea that can infect and systemic and can cause harm to the fish farming. Vaccination is an attempt to cause-specific endurance through vaccination. Observations differential leukocytes and increased optical density values can be used to determine the effectiveness of the vaccine is given. This study aims to analyze the immune response koi fish vaccinated with Myxobolus koi spores whole protein for vaccine development myxobolusis in koi fish. The method used in this study is Completely Randomized Design with 4 treatments and 5 replications. The results showed that a change in the total number and types of leukocytes that can be used as indicators of the presence of certain infectious diseases that occure in fish. The highest value of lymphocytes in treatment B, monocytes highest in treatment D, neutrophils on treatment D, eosinophils on treatment A and basophils highest in treatment A. The observation of the highest optical density value in treatment B (fish vaccinated and infected 80 M. koi spores / tail) of 0.593 at day 30, while the lowest in treatment D (fish are not vaccinated but diinveksi 80 M. koi spores / tail) of 0,064 in 30 day

    Inhibition of Apoptosis in Retinal of Newborn Mice Due to Congenital Toxoplasmosis

    Full text link
    Toxoplasma gondii infection in pregnant women cause defects in the newborn, such as hydrocephalus and eye damaged, even blindness. Histologically damage due to congenital infection of T. gondii need to be examined. Twenty pregnant mice were divided into two groups which are the treatment group and the control group. Each mouse in treatment group was infected with 10 takizoit by intraperitoneal. Each of the newborn were sacrified, their head were taken and their eye tissue were fixed in 10% of buffered formalin and the histological sample were made in HE and TUNEL staining. The result showed that the retina of the eye of the newborn from infected mice damage. The damages include: hemorrhage, infected retinal cells, eye growth inhibition and decreased of apoptosis index of the retina cells

    Keragaman Gen Cytochrome B Pada Sidat (Anguila Bicolor) Berdasarkan Restriction Fragment Length Polymorphism (RFLP) [Genetic Diversity Cythochrome B of Sidat (Anguila Bicolor) Assesed by Restriction Fragment Length Polymorhisme (RFLP) ]

    Full text link
    This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 ') . PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %
    corecore