2,312 research outputs found
Divergent roles of CprK paralogues from Desulfitobacterium hafniense in activating gene expression
Gene duplication and horizontal gene transfer play an important role in the evolution of prokaryotic genomes. We have investigated the role of three CprK paralogues from the cAMP receptor protein-fumarate and nitrate reduction regulator (CRP-FNR) family of transcriptional regulators that are encoded in the genome of Desulfitobacterium hafniense DCB-2 and possibly regulate expression of genes involved in the energy-conserving terminal reduction of organohalides (halorespiration). The results from in vivo and in vitro promoter probe assays show that two regulators (CprK1 and CprK2) have an at least partially overlapping effector specificity, with preference for ortho-chlorophenols, while meta-chlorophenols proved to be effectors for CprK4. The presence of a potential transposase-encoding gene in the vicinity of the cprK genes indicates that their redundancy is probably caused by mobile genetic elements. The CprK paralogues activated transcription from promoters containing a 14 bp inverted repeat (dehalobox) that closely resembles the FNR-box. We found a strong negative correlation between the rate of transcriptional activation and the number of nuclecitide changes from the optimal dehalobox sequence (TTAAT-N-4-ATTAA). Transcription was initiated by CprK4 from a promoter that is situated upstream of a gene encoding a methyl-accepting chemotaxis protein. This might be the first indication of taxis of an anaerobic bacterium to halogenated aromatic compounds
Detailed in situ hot stage transmission electron microscope observations of the localized pinning of a mobile ferrite-austenite interface in a Fe-C-Mn alloy by a single oxidic particle
The current study reports the detailed analysis of an observation of the local pinning of a slowly moving austenite-ferrite interface by a single nanosized oxidic particle. The observations were made during an in situ cyclic partial phase transformation experiment on a Fe-0.1C-1.0Mn alloy close to the inversion stage at which the interface migrates at a rather low velocity. The low velocity allowed capturing the interface pinning effect over a period of no less than 16 seconds. From our observations, it was possible to follow the progression of the pinning effect from the initial stages all the way through to the release of the interface. The pinning force exerted by the individual particle having a diameter of 140 nm on the austenite-ferrite interface was estimated as 175 nJ m−1, while the maximum pinning length was approximately 750 nm to either side of the particle, leading to an interface line tension of 170 nJ m−1. The observed pinning behavior is compared with the most relevant models in the literature
The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis
The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos
A business case or social responsibility? How top managers’ support for work-life arrangements relates to the national context
Cellular and Molecular Mechanisms in Hypertrophic Scar Formation: Potential Targets for Therapy
Middelkoop, E. [Promotor]Molema, G. [Promotor]Niessen, F.B. [Copromotor
Air loads on a rigid plate oscillating normal to a fixed surface
This paper deals with the theoretical and experimental investigation on a rigid, rectangular plate oscillating in the proximity of a fixed surface. The plate is suspended by springs. The airloads generated by the oscillating motion of the plate are determined. Due to the fact that the plate is rigid, the system is modelled as a 1-DOF system. The influence of the surrounding air is detected by changes in the plate's natural frequency and damping. For the behaviour of the air in the gap between the plate and the fixed surface an analytical solution is presented. This solution includes the effects of inertia, viscosity, compressibility and thermal conductivity. It is shown that the main parameters governing the motion of the air in the gap are the shear wave number, the reduced frequency, the narrowness of the gap and the aspect ratio of the plate. With these parameters the validity of several simplifications can easily be demonstrated and solutions, given in the literature, can be put in perspective. Special experiments were carried out with an oscillating solar panel in order to verify the analytical model. The analytical results and the experimental results show fair agreement. The solutions shows that for low shear wave numbers the effects of viscosity cannot be discarded. \u
- …