Occurrence and characterization of a severe isolate of Watermelon mosaic virus from Argentina

More than 50 viruses have been reported in cucurbit crops worldwide. In Argentina, cucurbit viruses have been associated with important yield losses. The most prevalent and widespread potyvirus is Watermelon mosaic virus (WMV). WMV was detected in Argentina in all cucurbit species with high incidence. In this study, a WMV isolate (WMV 1 SDE FF) was obtained from a naturally infected squash associated with a severe outbreak on melon and squash crops in an important cucurbit growing area in Santiago del Estero province (Argentina), during a survey conducted in November 2012. The fully sequenced WMV 1 SDE FF genome consists of 10,027 nucleotides and shares 96 % nt identity and 98 % aa identity with the French isolates JF273464.1|C07–014 and EU660581.1|FMF00-LL1 of the WMV molecular group 3. Using the recombination detection program RDP4, two statistically significant recombination events were identified: event 1, an 830-nt long recombinant fragment in the putative P1 coding region, and event 2, a 4071-nt recombinant fragment detected across the HC Pro, P3 and CI coding regions. The putative parental sequences detected for event 1 were the EU660586.1| FBR04–37 (major parent) and JF273468.1|C07–284 (minor parent), both from France. Putative parental sequences for event 2 were JX079685.1| WMV-ShanXi (major parent) and HQ384216.1|Dendrobium (minor parent), from China and USA, respectively. To our knowledge, this is the first complete genome of an Argentine WMV isolate. Our results provide evidence that WMV 1 SDE FF is the causal agent of the strong outbreak reported in melon and squash fields in recent years.Inst. Patología VegetalFil: Perotto, Maria Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Pozzi, Elizabeth Alicia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Luciani, Cecilia E. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentin

The Genetic Makeup of Myeloproliferative Neoplasms: Role of Germline Variants in Defining Disease Risk, Phenotypic Diversity and Outcome

Myeloproliferative neoplasms are hematologic malignancies typified by a substantial heritable component. Germline variants may affect the risk of developing a MPN, as documented by GWAS studies on large patient cohorts. In addition, once the MPN occurred, inherited host genetic factors can be responsible for tuning the disease phenotypic presentation, outcome, and response to therapy. This review covered the polymorphisms that have been variably associated to MPNs, discussing them in the functional perspective of the biological pathways involved. Finally, we reviewed host genetic determinants of clonal hematopoiesis, a pre-malignant state that may anticipate overt hematologic neoplasms including MPNs

Targeting Methyltransferases in Human Pathogenic Bacteria: Insights into Thymidylate Synthase (TS) and Flavin-Dependent TS (FDTS)

In cells, thymidylate synthases provide the only de novo source of 2'-deoxythymidine-5'-monophosphate (dTMP), required for DNA synthesis. The activity of these enzymes is pivotal for cell survival and proliferation. Two main families of thymidylate synthases have been identified in bacteria, folate-dependent thymidylate synthase (TS) and flavin-dependent TS (FDTS). TS and FDTS are highly divergent enzymes, characterized by exclusive catalytic mechanisms, involving different sets of cofactors. TS and FDTS mechanisms of action have been recently revised, providing new perspectives for the development of antibacterial drugs targeting these enzymes. Nonetheless, some catalytic details still remain elusive. For bacterial TSs, half-site reactivity is still an open debate and the recent evidences are somehow controversial. Furthermore, different behaviors have been identified among bacterial TSs, compromising the definition of common mechanisms. Moreover, the redox reaction responsible for the regeneration of reduced flavin in FDTSs is not completely clarified. This review describes the recent advances in the structural and functional characterization of bacterial TSs and FDTSs and the current understanding of their mechanisms of action. Furthermore, the recent progresses in the development of inhibitors targeting TS and FDTS in human pathogenic bacteria are summarized

First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops

Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. ?cayote?, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina. Instituto Nacional de Tecnologia Agropecuaria. Centro Regional Cordoba. Estacion Experimental Agropecuaria Marcos Juarez. Agencia de Extension Rural Bell Ville.; ArgentinaFil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Conci, Vilma Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Perotto, Maria Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentin

Fusarium solani infection after antimicrobial treatment of a severe bacterial peritonitis: a case report and review of the literature

Fungal peritonitis is a rare but serious complication of peritoneal dialysis. This infection has been reported to be mostly caused by Candida species, and less frequently by a variety of other yeasts and moulds, such as Aspergillus, Penicillium, and  Fusarium spp. are commonly isolated from soil, plants and environmental surfaces, and rarely from non-immunosuppressed subjects. In this report, author describe a case of infection caused by Fusarium solani in a 59-year-old man undergoing continuous ambulatory peritoneal dialysis. The fungus was recovered from cultures of peritoneal dialysate and the pathogen identification was carried out by mass spectrometry. The patient's outcome was favorable without complications after liposomal amphotericin B treatment along with peritoneal dialysis catheter removal

Efectos del clima y el nivel del agua sobre la reproducción de aves acuáticas coloniales en Laguna Mar Chiquita - Bañados del Río Dulce (Argentina Central)

En el presente trabajo se exploró la relación entre factores relacionados al clima y la reproducción de aves acuáticas coloniales en un extenso humedal del centro de Argentina, el sistema Laguna Mar Chiquita - Bañados del Río Dulce. Debido a sus distintos requerimientos ecológicos, las diversas especies presentaron respuestas disímiles a las variaciones de los factores climáticos, los cuales a su vez actúan a distintas escalas espaciales. El éxito reproductivo de casi todas las especies fue negativamente afectado por el viento durante las tormentas que se forman localmente durante el verano. Las variaciones en el nivel del agua, producidas por fenómenos no locales sino ocurridos en la parte alta de la cuenca, a gran distancia del humedal, tuvieron una acción directa sobre el número de especies en colonias. El número de parejas, en cambio, no fue directamente afectado por dichas variaciones, aunque el número de parejas en colonias de la Garcita Azulada (Butorides striata) estuvo relacionado al área de hábitat óptimo disponible para la alimentación y nidificación de esta especie, superficie que en definitiva fue regulada por el nivel del agua. La formación de colonias de aves acuáticas estuvo supeditada a niveles estables o con variaciones de hasta 1 m entre un año y el siguiente. Los datos obtenidos presentan implicancias para la biología de la conservación y las estrategias de manejo del agua.The relationship between climate-related factors in an important extensive wetland of central Argentina (Laguna Mar Chiquita - Bañados del Río Dulce) and colonial waterbirds reproduction was explored. Due to their different ecological requirements, the diverse species responded differently to variations in climatic factors, which in turn interact at different spatial scales. Nesting success of almost all species was negatively affected by storm winds occurring in the region in summer. Water level changes, induced by non-local phenomena occurring in the high basin, at a great distance from the Mar Chiquita– Dulce River system, had a direct effect on species number in colonies. On the contrary, pair numbers was not directly affected by water level changes, although the pair numbers in the Striated Heron (Butorides striata) colonies was related to the area of the feeding and nesting habitat suitable for this species, which was eventually regulated by water level. Waterbirds colony formation depended on water levels that were stable or changed in up to 1 m in consecutive years. The data obtained has implications for biodiversity conservation and water management strategies.Fil: Torres, Ricardo Marcelo. Universidad Nacional de Córdoba; ArgentinaFil: Michelutti, Matias Pablo. No especifica;Fil: Dominino, Jael. Administración Nacional de Parques; ArgentinaFil: León, José Gabriel. Consejo Nacional de Investigaciones Científicas y Técnicas. Centro Científico Tecnológico Conicet - Mendoza. Instituto Argentino de Nivología, Glaciología y Ciencias Ambientales. Provincia de Mendoza. Instituto Argentino de Nivología, Glaciología y Ciencias Ambientales. Universidad Nacional de Cuyo. Instituto Argentino de Nivología, Glaciología y Ciencias Ambientales; ArgentinaFil: Mangeaud, Arnaldo. Universidad Nacional de Córdoba; ArgentinaFil: Rodriguez, Andres. Universidad Nacional de Córdoba; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Pozzi Piacenza, Cecilia Elena. Universidad Nacional de Córdoba; ArgentinaFil: Plencovich, Gonzalo. Universidad Nacional de Córdoba; ArgentinaFil: Pagot, Mariana. Universidad Nacional de Córdoba; ArgentinaFil: Hillman, Gerardo. Universidad Nacional de Córdoba; Argentin