"The Paradox of Migration: Reconciling Economic Competition and 'Common Values' in Britain"

[From the introduction] This paper looks at Great Britain as an important case for explaining the inherent paradox of migration policy in Western Europe. Where immigration is an opportunity to jump-start latent industrial or struggling service economies, it is also a dominant political challenge in maintaining national identity and cohesion. This is particularly the case for Britain, where national identity is an inchoate, regularly re-defined concept (see Cesarani 1997; Hampshire 2006). Britain has seen positive economic growth and production in opening up their labor market to over half a million A-8 Accession workers, mainly from Poland and Lithuania. And under the banner of “controlled migration,” the Labor government has introduced a five-tiered, point-based entry system to bring highly skilled and need-based non-European migrants to Britain. However, where there is a desire to meet economic needs through migration, immigration has never been more of a contested, salient political issue. The promotion of citizenship requirements emphasizing integration (in English language and UK knowledge assessment) for non-EEA migrants, is an important innovation for defining British national identity, articulating for the first time a set of ‘common values’ to underscore the British national community. Britain’s migration calculus, maximizing the economic and social benefits of immigration against the efforts to isolate potential costs of immigration through the first, real definition of “Britishness” exemplifies the inherent paradox of migration for Western European states where more formed or consolidation visions of nation-state pre-dated large-scale migration. Following a review of context in which migration and citizenship laws were changed, discussing Britain’s strategic use of European Enlargement as being able to maintain selective admission alongside economic openness, the second part looks at British policy in detail by examining the most recent development of immigration and citizenship policy, beginning with the 2002 White Paper “Secure Borders, Safe Haven,” and manifesting in the 2005 Five-year strategy, “Controlling Our Borders.” Finally, I conclude with preliminary comparisons between Britain and other Western European countries, who are only now coming to terms with the realization that they are ‘countries of immigration,’ taking on all the benefits and responsibilities that come with it

A Micro Financing Framework for Rural Water and Sanitation Provisioning in Sub-Saharan Africa

This paper investigates potential issues with regard to water and sanitation. It argues that technological fixes alone are not enough and need to be complemented by other forms of innovation such as local community organization and financial innovation. It provides a micro financing framework that is founded on the Rotating Savings and Credit Associations (RoSCA) arrangements at the village level

Speech-Language Pathology Students’ Perceptions of an IPE Stroke Workshop: A One-Year Follow up

Interprofessional education (IPE) activities are increasingly included in speech-language pathology (SLP) curriculum; however, little is known about IPE’s impact on students’ clinical experiences. Additionally, few studies have examined students’ perceptions of IPE Competency Domains across a program of study or within specific IPE activities. For this initial study, qualitative and quantitative analyses of 24 SLP students’ survey responses one year after an IPE Stroke Workshop highlighted the value of IPE. Students emphasized the importance of hands on and real life activities as part of interprofessional learning. Additionally, their responses suggest that multiple IPE Competency Domains may be addressed within a single IPE activity; however, students’ misconceptions of IPE may limit their report of IPE Competency Domains covered. These findings provide insight to assist with integration of IPE to meet the needs of SLP students

Comparative Mammalian Dental Enamel Histology

Using light and scanning electron microscopy, this research documents similarities and differences in the enamel composition of human, dog, pig, and deer teeth. The main focus is on the Hunter-Schreger band (HSB) phenomena characteristic to mammalian dental enamel. The human teeth are controls to which comparisons are made. Deciduous and permanent maxillary and mandibular incisors, canines, premolars, molars were examined from labio-lingual and mesio-distal thin sections. HSBs in mammals compared to humans proved to show width and length differences while their enamel prism size did not vary across species. It is believed that human tooth enamel compared to other mammals can be a distinctive factor in the recovery process of comingled remains to determine to whom the tooth belongs

‘The Meditations as Meditation?: The Significance of Reading Descartes’ Meditations on First Philosophy from a Meditational Perspective’

This project considers the significance of the title of Descartes’ Meditations, asking questions of the nature and extent of the influence of the meditational genre on the text. Approaching the text from a meditational perspective is shown to be highly illuminative. Meditation is not just one ‘aspect’ of the text; rather, it impacts on its very nature, purpose and meaning. Despite the quantity of research on the Meditations, the text often meets with heavy criticism. This is at least partly due to the way the text is approached; the compartmentalisation of ‘problems’ in the text, and the sidelining of ‘literary’ considerations in favour of the ‘philosophical’, create a fractured representation of the text. This thesis promotes philosophical and literary interdependency, by focusing the reader’s attention on the role of meditation in informing the text. It offers a fresh approach to the Meditations. The thesis draws on comparisons with St. Ignatius of Loyola’s Spiritual Exercises, to assess if, and in what way, this type of meditational writing informed the Meditations. The thesis establishes a basic connection between Ignatius and Descartes, before giving Descartes a voice in explaining why he chose to so title his work, emphasising epistemological considerations. The final part builds a picture of how the meditational genre impacts on the reader’s interpretation of the Meditations. By focusing on the importance of how the text is read, a consideration of the title is shown to be key in bringing about a more balanced understanding of the text. This sympathetic approach renders some of the classic ‘Cartesian problems’ less threating to Descartes’ project. Furthermore, reforming the way we read the Meditations has wider implications for handling other philosophical and theological texts. The focus on considerations of style and genre can be applied more widely, paving the way for fruitful textual interpretation

Structural studies on DNA G-quadrupIexes

Guanine-rich lengths of DNA are capable of self-assembly into higher order structures known as G-quadruplexes. Guanine rich DNA sequences from a range of biologically relevant regions in the human genome, most notably telomeric DNA, have been observed to form such structures. To date a wide variety of quadruplex structures have been experimentally determined. This thesis is primarily concerned with the characterisation of a G-rich region of DNA from the c-kit oncogene promoter region. This work investigates the ability of this sequence, d(AGGGAGGGCGCTGGGAGGAGGG) (known as c-kit I), to form quadruplex structures using a range of biophysical techniques, principally nuclear magnetic resonance, UV melting studies and CD spectroscopy. The structural and thermodynamic properties of a quadruplex forming from this sequence are comprehensively examined. G-quadruplexes are known to be sensitive to small mutations in their loop regions and a series of three mutated sequences was created with the aim of elucidating the effects of mutations on the quadruplex forming ability of this region of G-rich DNA. The effect of each mutation was examined using the biophysical methods outlined above. Molecular dynamics simulations have also been performed to investigate three different quadruplex topologies that this sequence may adopt in the solution phase. Free-energy calculations were undertaken to investigate the relative stabilities of the possible folds. The molecular dynamics simulations also provide an insight into the behaviour of the loop regions for a range of possible loop topologies. Ligand interaction with a model of the parallel c-kit I quadruplex was also studied by molecular dynamics in order to provide a structural rationale for ligand binding. A range of acridine-based ligands were studied and the model was validated by comparison with experimentally observed binding affinities. Modelling studies were also undertaken to examine the relative behaviour of two human telomeric quadruplex structures. Results show that the c-kit 1 sequence is capable of forming a single quadruplex species with a novel parallel motif. The sequence is highly sensitive to mutation; modified sequences do not show any quadruplex forming ability. Modelling studies on the human telomeric quadruplex folds reveal that base pairing contributes significantly to the overall stability of the 3+1 fold. The availability of these bases to participate in pairing interactions in vivo may determine the viability of the mixed fold in a cellular environment