982 research outputs found
Health benefits and health claims of probiotics: bridging science and marketing
Health claims for probiotics are evaluated by the Panel on Dietetic Products, Nutrition and Allergies of the European Food Safety Authority. Despite a substantial amount of basic and clinical research on the beneficial effects of probiotics, all of the evaluated claim applications thus far have received a negative opinion. With the restrictions on the use of clinical endpoints, validated biomarkers for gut health and immune health in relation to reduction in disease risk are needed. Clear-cut criteria for design as well as evaluation of future studies are needed. An open dialogue between basic and clinical scientists, regulatory authorities, food and nutrition industry, and consumers could bridge the gap between science and marketing of probiotic
The host genotype affects the bacterial community in the human gastrointestinal tract
The gastrointestinal (GI) tract is one of the most complex ecosystems consisting of microbial and host cells. It is suggested that the host genotype, the physiology of the host and environmental factors affect the composition and function of the bacterial community in the intestine. However, the relative impact of these factors is unknown. In this study, we used a culture-independent approach to analyze the bacterial composition in the GI tract. Denaturing gradient gel electrophoresis (DGGE) profiles of fecal bacterial 16S rDNA amplicons from adult humans with varying degrees of genetic relatedness were compared by determining the similarity indices of the profiles compared. The similarity between fecal DGGE profiles of monozygotic twins were significantly higher than those for unrelated individuals (ts = 2.73, p1-tail = 0.0063, df=21). In addition, a positive relationship (F1, 30 = 8.63, p = 0.0063) between the similarity indices and the genetic relatedness of the hosts was observed. In contrast, fecal DGGE profiles of marital partners, which are living in the same environment and which have comparable feeding habits, showed low similarity which was not significantly different from that of unrelated individuals (ts = 1.03, p1-tail = 0.1561, df=27). Our data indicate that factors related to the host genotype have an important effect on determining the bacterial composition in the GI tract
Victivallis vadensis gen. nov., sp. nov., a sugar-fermenting anaerobe from human faeces
A novel strictly anaerobic, cellobiose-degrading bacterium, strain Cello, was isolated from a human faecal sample by combining enrichments in liquid and soft-agar basal media. A noteworthy characteristic was its inability to grow on normal agar plates and in roll tubes. The cells were coccus shaped and non-motile, with an extracellular slime layer. Growth of strain Cello T occurred between 20 and 40 degreesC, with optimal growth at 37 degreesC. The pH range for growth was 5-7-5 with an optimum at 6-5. In pure culture, strain Cello T could only grow on a variety of sugars. Glucose was converted to acetate, ethanol and H-2. The doubling time on glucose was 0.5 h. In a syntrophic co-culture with Methanospirillum hungatei strain JF-1(T), strain Cello(T) converted glucose to acetate and H-2. The G+C content was 59.2 mol%. 16S rDNA analysis revealed that the closest relatives of strain Cello(T) were two uncultured bacteria from anaerobic digesters, both with 94% 16S rDNA sequence similarity. The closest cultured representatives belong to genera of the bacterial division 'Verrucomicrobia'. The name Victivallis vadensis gen. nov., sp. nov. is proposed for strain Cello(T) (=DSM 14823(T) =ATCC BAA-548(T))
Divergent roles of CprK paralogues from Desulfitobacterium hafniense in activating gene expression
Gene duplication and horizontal gene transfer play an important role in the evolution of prokaryotic genomes. We have investigated the role of three CprK paralogues from the cAMP receptor protein-fumarate and nitrate reduction regulator (CRP-FNR) family of transcriptional regulators that are encoded in the genome of Desulfitobacterium hafniense DCB-2 and possibly regulate expression of genes involved in the energy-conserving terminal reduction of organohalides (halorespiration). The results from in vivo and in vitro promoter probe assays show that two regulators (CprK1 and CprK2) have an at least partially overlapping effector specificity, with preference for ortho-chlorophenols, while meta-chlorophenols proved to be effectors for CprK4. The presence of a potential transposase-encoding gene in the vicinity of the cprK genes indicates that their redundancy is probably caused by mobile genetic elements. The CprK paralogues activated transcription from promoters containing a 14 bp inverted repeat (dehalobox) that closely resembles the FNR-box. We found a strong negative correlation between the rate of transcriptional activation and the number of nuclecitide changes from the optimal dehalobox sequence (TTAAT-N-4-ATTAA). Transcription was initiated by CprK4 from a promoter that is situated upstream of a gene encoding a methyl-accepting chemotaxis protein. This might be the first indication of taxis of an anaerobic bacterium to halogenated aromatic compounds
Molecular biological methods for studying the gut microbiota : the EU human gut flora project
Seven European laboratories co-operated in a joint project (FAIR CT97-3035) to develop, refine and apply molecular methods towards facilitating elucidation of the complex composition of the human intestinal microflora and to devise robust methodologies for monitoring the gut flora in response to diet. An extensive database of 16S rRNA sequences for tracking intestinal bacteria was generated by sequencing the 16S rRNA genes of new faecal isolates and of clones obtained by amplification with polymerase chain reaction (PCR) on faecal DNA from subjects belonging to different age groups. The analyses indicated that the number of different species (diversity) present in the human gut increased with age. The sequence information generated, provided the basis for design of 16S rRNA-directed oligonucleotide probes to specifically detect bacteria at various levels of phylogenetic hierarchy. The probes were tested for their specificity and used in whole-cell and dot-blot hybridisations. The applicability of the developed methods was demonstrated in several studies and the major outcomes are described
Recent Developments and Practical Feasibility of Polymer-Based Antifouling Coatings
While nature has optimized its antifouling strategies over millions of years, synthetic antifouling coatings have not yet reached technological maturity. For an antifouling coating to become technically feasible, it should fulfill many requirements: high effectiveness, long-term stability, durability, ecofriendliness, large-scale applicability, and more. It is therefore not surprising that the search for the perfect antifouling coating has been going on for decades. With the discovery of metal-based antifouling paints in the 1970s, fouling was thought to be a problem of the past, yet its untargeted toxicity led to serious ecological concern, and its use became prohibited. As a response, research shifted focus toward a biocompatible alternative: polymer-based antifouling coatings. This has resulted in numerous advanced and innovative antifouling strategies, including fouling-resistant, fouling-release, and fouling-degrading coatings. Here, these novel and exciting discoveries are highlighted while simultaneously assessing their antifouling performance and practical feasibility
The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis
The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos
A History of Aboriginal Sydney…digitally delivering the past to the present
For more than two centuries, the history of the Indigenous people of the Sydney region has remained locked away in archives, held within families, or obliterated by the dominant culture. Now, with community approval and co-operation, our project, A history of Aboriginal Sydney, is beginning to use digital tools to restore Sydney's Aboriginal history in forms which can be appreciated and shared by the families themselves, by high school students and by everyone who values the history and culture of Australia's first peoples. Our project is based on the developing knowledge management platform, which integrates historical records, methods and tools of e-scholarship, and solutions for delivering research data for different uses. The project team employs methods such as marking of topic threads, and linking data with interactive timelines and digital maps to enable online learning and information discovery on the website . The project itself is based in the Department of History, University of Sydney and is funded by an Australia Research Council, Australian Professorial Fellowship and Discovery Grant. The research data are archived in ATSIDA (Aboriginal and Torres Strait Islander Data Archive), which provides long-term preservation and manages appropriate access to the data.ARC, ATSID
Functional genomics of lactic acid bacteria: from food to health
Genome analysis using next generation sequencing technologies has revolutionized the characterization of lactic acid bacteria and complete genomes of all major groups are now available. Comparative genomics has provided new insights into the natural and laboratory evolution of lactic acid bacteria and their environmental interactions. Moreover, functional genomics approaches have been used to understand the response of lactic acid bacteria to their environment. The results have been instrumental in understanding the adaptation of lactic acid bacteria in artisanal and industrial food fermentations as well as their interactions with the human host. Collectively, this has led to a detailed analysis of genes involved in colonization, persistence, interaction and signaling towards to the human host and its health. Finally, massive parallel genome re-sequencing has provided new opportunities in applied genomics, specifically in the characterization of novel non-GMO strains that have potential to be used in the food industry. Here, we provide an overview of the state of the art of these functional genomics approaches and their impact in understanding, applying and designing lactic acid bacteria for food and health
- …