Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5’CACACGGTTGTATGTCGGTTTCGCT3’ and oligo 2: 5’TCAAGGAGCTCAATGTTAC GCT3’. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia

Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable by Polymerase Reaction Chain

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets. The PCR against B1 gene as target was performed by using the method described by Chang & Ho. Two methods described by Weiss et al and Chang & Ho were used against P30 gene as target. The B1 gene primers consisted of oligo 1 :5’GGAACTGCATCCGTTCAGA G3’ and oligo 2 : 5’TCTTTAAAGCGTTCGTGGTC3’, whereas the P30 gene primers consisted of oligo 1 : 5’CACACGGTTGTATGTCGGTTTCG CT3’ and oligo 2 : 5’TCAAGG AGCTCAAT GTTACAGCCT3’. It was shown that no specific bands were observed in the PCR with P30 gene as target using the method by Weiss et al. With the method Chang & Ho the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target.&nbsp

Deteksi Zat Anti Skizon Plasmodium Falciparum dengan Elisa: (suatu Penelitian Pendahuluan)

A preliminary study based on ELISA was done to evaluate anti-malarial antibodies on 35 persons living in a hypoendemic area, Wonosobo, Central Java. Schizonts of Plas­modium falciparum strain Flores cultured in vitro were extracted and used as antigen. As negative controls, 27 sera were drawn from British persons who had never been visiting endemic area. The result showed that 20% (7/35) of the sample contained anti-malaria antibodies, however, by using chi-square test and Yate's correction it was shown that there was no significant difference between group of persons with parasite and/or splenomegaly compared to group of persons without parasite and without splenomegaly (p > 0.05)