O6-[(2”,3”-O-Isopropylidene-5”-O-tbutyldimethylsilyl)pentyl]- 5′-O-tbutyldiphenylsilyl-2′,3′-O-isopropylideneinosine

Cyclic adenosine diphosphate ribose (cADPR) is a cyclic nucleotide involved in the Ca2+ homeostasis. In its structure, the northern ribose, bonded to adenosine through an N1 glycosidic bond, is connected to the southern ribose through a pyrophosphate bridge. Due to the chemical instability at the N1 glycosidic bond, new bioactive cADPR derivatives have been synthesized. One of the most interesting analogues is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine replaced adenosine. The efforts for synthesizing new linear and cyclic northern ribose modified cIDPR analogues led us to study in detail the inosine N1 alkylation reaction. In the last few years, we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. With the aim to obtain the closest flexible cIDPR analogue, we have attached to the inosine N1 position a 2”,3”-dihydroxypentyl chain, possessing the two OH groups in a ribose-like fashion. The inosine alkylation reaction afforded also the O6-alkylated regioisomer, which could be a useful intermediate for the construction of new kinds of cADPR mimics

President Obama’s Humble Face: An Authentic or a Socially Desirable Posturing? A Study on Reactions to Obama’s Autobiographical Self-Disclosures

Referring to the mainstream studies based on the personalization’s hypothesis, which positively evaluates signals of dominance shown by leaders, the analysis of Obama’s rhetoric stays a relevant exception. His risky recall, during his political talks, of his social difficulties as a child of a mixed couple was in fact one of the more surprising aspects of his success. Nevertheless, reactions to his autobiographical sharing were scarcely explored. Based on the idea that these self-disclosures signal his responsivity toward the audience of low social condition and can, therefore, be defined as a sign of humility, this research aims to test if coherence between Obama’s words and his facial expressions of contempt, due to the seriousness of social injustices endured in his childhood, may influence the receivers’ perception of such unexpected communication. Before reading a brief autobiographical sharing taken from a “Back-to-school” speech, a highly ritualized monolog the US President addresses each year to students, 175 Italian participants were presented with a photo of Obama displaying either an expression of contempt (taken from the video of the speech) or a neutral expression. Comparisons between self-assessments of perceptions and reactions of participants assigned to the two experimental conditions show that a facial expression of contempt, coherent with words describing his school difficulties, has been crucial for perceiving this humble political discourse as authentic and not as a simple socially desirable posturing. More studies seem to be needed, however, to understand how humble speech could enhance the positive face of leaders or backfire against them

Sars-CoV-2 Infection Prompts IL-1β-Mediated Inflammation and Reduces IFN-λ Expression in Human Lung Tissue

Two years after its spreading, the severe acute respiratory syndrome coronavirus 2 (SARSCoV-2) is still responsible for more than 2000 deaths per day worldwide, despite vaccines and monoclonal antibody countermeasures. Therefore, there is a need to understand the immune–inflammatory pathways that prompt the manifestation of the disease to identify a novel potential target for pharmacological intervention. In this context, the characterization of the main players in the SARS-CoV-2-induced cytokine storm is mandatory. To date, the most characterized have been IL-6 and the class I and II interferons, while less is known about the proinflammatory cytokine IL-1β and class III interferons. Here, we report a preliminary study aimed at the characterization of the lung inflammatory context in COVID-19 patients, with a special focus on IFN-λ and IL-1β. By investigating IFN and inflammatory cytokine patterns by IHC in 10 deceased patients due to COVID-19 infection, compared to 10 control subjects, we reveal that while IFN-β production was increased in COVID-19 patients, IFN-λ was almost abolished. At the same time, the levels of IL-1β were dramatically improved, while IL-6 lung levels seem to be unaffected by the infection. Our findings highlight a central role of IL-1β in prompting lung inflammation after SARS-CoV-2 infection. Together, we show that IFN-λ is negatively affected by viral infection, supporting the idea that IFN-λ administration together with the pharmaceutical blockage of IL-1β represents a promising approach to revert the COVID-19-induced cytokine storm

Old and Promising Markers Related to Autophagy in Traumatic Brain Injury

Traumatic brain injury (TBI) is one of the first causes of death and disability in the world. Because of the lack of macroscopical or histologic evidence of the damage, the forensic diagnosis of TBI could be particularly difficult. Considering that the activation of autophagy in the brain after a TBI is well documented in literature, the aim of this review is to find all autophagy immunohistological protein markers that are modified after TBI to propose a method to diagnose this eventuality in the brain of trauma victims. A systematic literature review on PubMed following PRISMA 2020 guidelines has enabled the identification of 241 articles. In all, 21 of these were enrolled to identify 24 markers that could be divided into two groups. The first consisted of well-known markers that could be considered for a first diagnosis of TBI. The second consisted of new markers recently proposed in the literature that could be used in combination with the markers of the first group to define the elapsed time between trauma and death. However, the use of these markers has to be validated in the future in human tissue by further studies, and the influence of other diseases affecting the victims before death should be explored

Design and Synthesis of a cADPR Mimic as a Novel Tool for Monitoring the Intracellular Ca2+ Concentration

Cyclic ADP-ribose (cADPR, 1, Figure 1) is a naturally occurring metabolite of NAD+ capable of mobilizing Ca2+ ions from intracellular stores. It was firstly isolated from sea urchin egg extract, but it was later established that it is also produced in many other mammalian cells, including pancreatic β-cells, T-lymphocytes, smooth and cardiac muscle cells, and cerebellar neurons, acting as a Ca2+-mobilizing agent. For this activity, cADPR has been classified as a second messenger that, by activating the ryanodine receptors of the sarcoplasmatic reticulum, is able to mobilize the calcium ions from intracellular stores. cADPR is involved in many physiological processes related to variation in the Ca2+ concentration, such as synaptic homeostasis in neurons as well as fertilization and cellular proliferation. This cyclic nucleotide, characterized by a very labile glycosidic bond at N1, is also rapidly hydrolysed in neutral aqueous solutions to inactive ADP-ribose. Matsuda and co-workers [1] were the first to synthesize new analogues of cADPR in which the adenine base is replaced by a hypoxanthine ring. This kind of modification produced the cyclic inosine diphosphate ribose (cIDPR), which proved to be stable in hydrolytic physiological conditions and showed significant Ca2+ mobilizing activity. Many modifications regarding the northern and southern ribose, as well as the purine base of cADPR, have been proposed so far. In our laboratories, we have synthesized several analogues of cIDPR [2–7]. In particular, the analogue with the northern ribose replaced by a pentyl chain (cpIDP) showed interesting Ca2+ mobilizing activity on the neuronal PC12 cell line [2]. Starting from these results, we report here the synthesis of the novel analogue 2, in which the “northern” ribose of cIDPR is replaced by a 2″,3″-dihydroxy pentyl chain. The effect of the presence of the diol moiety on the intracellular Ca2+ release will be assessed in due course

Did Italy Really Need Compulsory Vaccination against COVID‐19 for Healthcare Workers? Results of a Survey in a Centre for Maternal and Child Health

Abstract: Since its early spread, the COVID‐19 pandemic has become a health threat globally. Due to their crucial role in the pandemic, Italy declared compulsory vaccination for healthcare workers. Vaccine hesitancy was observed among the healthcare workers and an ethical debate arose about Italian legal statement D.L. n. 44/2021. In this article, we present the results of a survey performed in an Italian center for maternal and infant care and assess the attitudes towards the COVID‐19 pandemic and the mandatory COVID‐19 vaccination of healthcare workers. Since March 2022, 91.5% of healthcare workers have been vaccinated with an additional dose. Only 2.3% of the respondents refused to take vaccination: the reasons behind this refusal were distrust, doubts over safety, and lack of information. Despite the high rate of response to vaccination, 17.7% of HCWs did not agree with its mandatory nature. In addition, 5.4% stated that they agreed to be vaccinated exclusively because of the sanctions provided for by the legislation. In conclusion, adequate vaccination coverage has been achieved in the hospital under consideration. However, it is still very important to continue to persuade HCWs of vaccine efficacy and safety, considering their social role

Sodium Nitrite Intoxication and Death: Summarizing Evidence to Facilitate Diagnosis

Background: Over the years, forensic pathology has registered the spread of new methods of suicide, such as the ingestion of sodium nitrite. Sodium nitrite causes increased methemoglobin, resulting in systemic hypoxia, metabolic acidosis, and cyanosis. Since sodium nitrite is a preservative, the ingestion of foods containing an excessive amount of this substance can also cause acute intoxication up to death. The present review is aimed at guiding health professionals in the identification and management of sodium-nitrite-related intoxications and deaths. Methods: A systematic literature search was carried out on PubMed by following the PRISMA statement’s criteria. A total of 35 studies with 132 cases were enrolled, and the data were cataloged in Microsoft Excel. To establish the causal correlation between sodium nitrite ingestion and death, the Naranjo Adverse Drug Reaction Probability Scale was used. Results: In addition to the small number of cases that have currently been published, the study demonstrated that there was a general methodological discrepancy in the diagnostic process. However, some interesting results have emerged, especially in post-mortem diagnostics. Conclusion: Sodium-nitrite-related deaths represent a challenge for forensic pathologists; therefore, it is important to promptly recognize the essential features and perform the necessary and unrepeatable examinations for the correct diagnosis of the cause of death

Bioconjugation of a PNA Probe to Zinc Oxide Nanowires for Label-Free Sensing

Zinc oxide nanowires (ZnONWs) are largely used in biosensing applications due to their large specific surface area, photoluminescence emission and electron mobility. In this work, the surfaces of ZnONWs are modified by covalent bioconjugation of a peptidic nucleic acid (PNA) probe whose sequence is properly chosen to recognize a complementary DNA (cDNA) strand corresponding to a tract of the CD5 mRNA, the main prognostic marker of chronic lymphatic leukemia. The interaction between PNA and cDNA is preliminarily investigated in solution by circular dichroism, CD melting, and polyacrylamide gel electrophoresis. After the immobilization of the PNA probe on the ZnONW surface, we demonstrate the ability of the PNA-functionalized ZnONW platform to detect cDNA in the μM range of concentration by electrical, label-free measurements. The specificity of the sensor is also verified against a non-complementary DNA sequence. These preliminary results highlight the potential application of PNA-bioconjugated ZnONWs to label-free biosensing of tumor markers

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations

Regulation of miRNAs as new tool for cutaneous vitality lesions demonstration in ligature marks in deaths by hanging

This study aims to demonstrate that the application of miRNA expression in forensic pathology, in cases of hanging, applying the method on skin samples. The proposed investigative protocol allowed us to highlight a different miRNA expression in the skin ligature marks of subjects who died by hanging compared to healthy skin control samples. The results obtained showed an increase in the expression of miRNAs recognized as regulators of the inflammatory response in skin lesions such as miR125a-5p and miR125b-5p. Furthermore, overexpression of additional miRNAs – miR214a-3p, miR128-3p, miR130a-3p, and miR92a-3p – with anti-inflammatory activity was highlighted. It was possible to document a statistical significance to control skin samples only for miR103a-3p (p < 0.05), miR214-3p and miR92a-3p (p < 0.01) The upregulation of miR222-3p and miR150-5p, respectively related to mast-cell activation and neutrophils after the application of traumatic stimuli supports the immunohistochemical data showed in literature. The diagnostic accuracy of miRNAs could expand the range of diagnostic tools available in the assessment of the vitality of a lesion