15 research outputs found
Immunotherapy with IgY Antibodies toward Outer Membrane Protein F Protects Burned Mice against Pseudomonas aeruginosa Infection
Burn patients with multidrug-resistant Pseudomonas aeruginosa infections commonly suffer from high morbidity and mortality, which present a major challenge to healthcare systems throughout the world. Outer membrane protein F (OprF), as a main outer membrane porin, is required for full virulence expression of P. aeruginosa. The aim of this study was to evaluate the protective efficacy of egg yolk-specific antibody (IgY) raised against recombinant OprF (r-OprF) protein in a murine burn model of infection. The hens were immunized with r-OprF, and anti-r-OprF IgY was purified using salt precipitation. Groups of mice were injected with different regimens of anti-OprF IgY or control IgY (C-IgY). Infections were caused by subcutaneous injection of P. aeruginosa strain PAO1 at the burn site. Mice were monitored for mortality for 5 days. The functional activity of anti-OprF IgY was determined by in vitro invasion assays. Immunotherapy with anti-OprF IgY resulted in a significant improvement in the survival of mice infected by P. aeruginosa from 25% to 87.5% compared with the C-IgY and PBS. The anti-OprF IgY decreased the invasion of P. aeruginosa PAO1 into the A549. Passive immunization with anti-OprF IgY led to an efficacious protection against P. aeruginosa burn infection in the burn model
Anti-EGFR bioengineered bacterial outer membrane vesicles as targeted immunotherapy candidate in triple-negative breast tumor murine model
Abstract Cancer immunotherapy employing checkpoint inhibitors holds great promise across diverse cancers; nonetheless, a substantial proportion of patients (ranging from 55 to 87%) remain unresponsive to this treatment. To amplify therapeutic efficiency, we propose a synergistic therapeutic strategy that entails the deployment of targeted nano-sized particles carrying Toll-like receptor (TLR) agonists to the tumor site. This innovative approach seeks to activate intratumoral antigen-presenting cells using bioengineered outer membrane vesicles (OMVs) derived from gram-negative bacteria. These OMVs possess inherent attributes of surface-exposed immune stimulators and TLR-activating components, rendering them intriguing candidates for investigation. These OMVs were meticulously designed to selectively target cancer cells exhibiting an overexpression of epidermal growth factor receptor (EGFR). To gauge the precision of this targeting, the conducted affinity-based assays aimed at determining the equilibrium dissociation constant of the single-chain variable fragment employed for this purpose. In vitro experiments confirmed the OMVs' proficiency in adhering to EGFR-overexpressed cancer cells. Moreover, the evaluation extended to an in vivo context, where the therapeutic effect of nanovesicles was appraised within the tumor microenvironment of the triple-negative breast cancer mouse model. Notably, both intraperitoneal and intratumoral administrations of nanovesicles exhibited the ability to activate natural killer cells and skew M2 macrophage towards an M1 phenotype. The combined scrutiny of in vitro and in vivo findings underscores the potential efficiency of OMVs as a promising strategy for future anti-tumor endeavors
Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens
Abstract Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection
A CssA, CssB and LTB chimeric protein induces protection against Enterotoxigenic Escherichia coli
Objectives: Enterotoxigenic Escherichia coli (ETEC), a major cause of diarrhea in children under 5, is an important agent for traveler's diarrhea. Heat-labile enterotoxin (LT) and colonization factors (CFs) are two main virulence mechanisms in ETEC. CS6 is one of the most prevalent CFs consisting of two structural subunits viz., CssA, CssB, necessary for attachment to the intestinal cells. Methods: In the present research, a chimeric trivalent protein composed of CssB, CssA and LTB was constructed. The chimeric gene was synthesized with codon bias of E. coli for enhanced expression of the protein. Recombinant proteins were expressed and purified. Mice were immunized with the recombinant protein. The antibody titer and specificity of the immune sera were analyzed by ELISA and Western blotting. Efficiency of the immune sera against ETEC was evaluated. Results: Antibody induction was followed by immunization of mice with the chimeric protein. Pretreatment of the ETEC cells with immunized animal antisera remarkably decreased their adhesion to Caco-2 cells. Discussion: The results indicate efficacy of the recombinant chimeric protein as an effective immunogen, which induces strong humoral response as well as protection against ETEC adherence and toxicity. Keywords: Enterotoxigenic Escherichia coli, CS6, Enterotoxin, Chimeric protei
Immunogenicity of enterotoxigenic Escherichia coli outer membrane vesicles encapsulated in chitosan nanoparticles
Objective(s): Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrheal disease in humans, particularly in children under 5 years and travelers in developing countries. To our knowledge, no vaccine is licensed yet to protect against ETEC infection. Like many Gram-negative pathogens, ETEC can secrete outer membrane vesicles (OMVs). These structures contain various immunogenic virulence proteins such as LT and therefore can be used as vaccine candidates. In this study we attempted to isolate the OMVs of ETEC cultivated at different temperatures and evaluate their immunogenicity and protective efficacy in a murine model of infection. Materials and Methods: OMVs was purified from bacterial supernatant by ultracentrifugation. OMVs were encapsulated in chitosan nanoparticles prepared by ionic gelation method within a layer of Eudragit L100 for oral delivery. Female BALB/c mice of 9 weeks’ old were immunized by parenteral injection and oral administration with free and encapsulated OMVs obtained from bacteria cultivated at 37°C and 42°C. The serum samples were collected and the antibody titers were measured by an enzyme-linked immunosorbent assay (ELISA). Results: The protein concentrations of OMVs were 3.47 mg/ml and 2.46 mg/ml for bacteria grown at 37°C and 42°C respectively. OMVs loaded into nanoparticles (NP-OMVs) were homogeneous and spherical in shape, with a size of 532 nm. The encapsulation efficiency of NP was 90%. Mice immunized with OMVs, inhibited the ETEC colonization in their small intestine and induced production of antibodies against LT toxin. Conclusion: The results obtained in this research place OMVs among promising candidates to be used for vaccination
Aptamer-based diagnosis of various SARS-CoV2 strains isolated from clinical specimens
The emergence of the SARS-CoV-2 virus, an unknown strain of coronavirus, has resulted in severe acute respiratory syndrome with high mortality rates worldwide. Due to the possibility of asymptomatic carriers, late diagnosis of infected individuals can lead to uncontrollable transmission of the disease, making early and accurate detection crucial in controlling the spread of the virus. In this study we identified high-binding-affinity aptamers targeting various strains of the SARS-CoV2 (COVID-19) virus, using the GO-Cell-SELEX (Graphene Oxide- Systematic Evolution of Ligands by Exponential Enrichment) strategy. A total of 96 aptamers were developed through 11 rounds of GO-Cell-SELEX from a random 40 nucleotide single-strand DNA (ssDNA) aptamer library. Using the surface plasmon resonance (SPR) method, the dissociation constant (Kd) values of all aptamers were calculated and two aptamers 52 and 91 with Kd 50 and 61 were selected for enzyme-linked apta-sorbent assay (ELASA). Aptamer 91 could detect various strains of the virus in above 97% of clinical samples obtained from nasopharyngeal swaps (NPS) specimens kept in viral transport media (VTM), confirmed by real-time PCR assay at COVID-19 Reference Diagnostic Laboratory of Iran, Pasture Institute. Aptamer 52 could detect the SARS-CoV2 virus in a competitive lateral flow assay (LFA) to be considered for a future designed kit. These two simple, specific, and sensitive tests can be used in combination for rapid and early diagnosis of various strains of the COVID-19 virus. Our results suggest that these two discovered aptamers present an opportunity for developing a new rapid aptamer-based coronavirus diagnostic kit