641 research outputs found
The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis
The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos
Immunohistochemical expression of SKALP/elafin in squamous cell carcinoma of the oesophagus.
In this study, the immunohistochemical expression of a new inducible elastase inhibitor, SKALP (skin-derived anti-leucoproteinase)/elafin, in the tissue of squamous cell carcinoma and uninvolved oesophageal mucosa was studied using a polyclonal rabbit anti-serum against SKALP/elafin. The results were compared with the immunohistochemical staining of proliferating cell nuclear antigen (PCNA) and the TUNEL assay in serial sections. In non-malignant oesophageal mucosa, the expression of SKALP/elafin was localized in the cells of the stratified zone overlying the PCNA-positive basal zone. In oesophageal cancer, the incidence of the expression was significantly related to the degree of the differentiation of the tumour. Characteristically, the expression was almost limited in tumour cell nests that had a clear squamous phenotype. In tumour cell nests, the expression of SKALP/elafin was localized in the cells overlying PCNA-expressing cells and no expression was found in the cells that expressed PCNA; DNA fragmentation was often observed in the same cell layers as those in which SKALP/elafin immunoreactivity was found. This enzyme inhibitor is speculated to be involved in the induction of the cell differentiation and apoptosis of human squamous cell carcinoma cells of the oesophagus
Anomalous Lattice Vibrations of Single and Few-Layer MoS2
Molybdenum disulfide (MoS2) of single and few-layer thickness was exfoliated
on SiO2/Si substrate and characterized by Raman spectroscopy. The number of
S-Mo-S layers of the samples was independently determined by contact-mode
atomic-force microscopy. Two Raman modes, E12g and A1g, exhibited sensitive
thickness dependence, with the frequency of the former decreasing and that of
the latter increasing with thickness. The results provide a convenient and
reliable means for determining layer thickness with atomic-level precision. The
opposite direction of the frequency shifts, which cannot be explained solely by
van der Waals interlayer coupling, is attributed to Coulombic interactions and
possible stacking-induced changes of the intralayer bonding. This work
exemplifies the evolution of structural parameters in layered materials in
changing from the 3-dimensional to the 2-dimensional regime.Comment: 14 pages, 4 figure
Circulating matrix metalloproteinases are associated with arterial stiffness in patients with type 1 diabetes: pooled analysis of three cohort studies
BACKGROUND: Altered regulation of extracellular matrix (ECM) composition by matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinase (TIMPs) may contribute to arterial stiffening. We investigated associations between circulating MMP-1, -2, -3, -9, -10 and TIMP-1, and carotid-femoral pulse wave velocity (cfPWV) and pulse pressure (PP), as markers of arterial stiffness in type 1 diabetic patients.
METHODS: Individuals with type 1 diabetes from three different cohorts were included in this study: EURODIAB Prospective Complications study (n = 509), LEACE (n = 370) and PROFIL (n = 638). Linear regression analyses were used to investigate cross-sectional associations between circulating levels of MMP-1, -2, -3, -9, -10, and TIMP-1 and cfPWV (n = 614) as well as office PP (n = 1517). Data on 24-h brachial and 24-h central PP were available in 638 individuals from PROFIL. Analyses were adjusted for age, sex, duration of diabetes, HbA1c, mean arterial pressure (MAP), and eGFR, and additionally for other cardiovascular risk factors and presence of vascular complications.
RESULTS: After adjustment for potential confounders and presence of vascular complications, circulating MMP-3 was associated with cfPWV [β per 1 SD higher lnMMP3 0.29 m/s (0.02; 0.55)]. In addition, brachial and central 24-h PP measurements in PROFIL were significantly associated with MMP-2 [(1.40 (0.47:2.33) and 1.43 (0.63:2.23)]. Pooled data analysis showed significant associations of circulating levels of MMP-1 and MMP-2 with office PP [β per 1 SD higher lnMMP-1 and lnMMP-2 = − 0.83 mmHg (95% CI − 1.50; − 0.16) and = 1.33 mmHg (0.55; 2.10), respectively].
CONCLUSIONS: MMPs-1, -2, and -3 are independently associated with markers of arterial stiffening in patients with type 1 diabetes and may become therapeutic targets
Associations of Advanced Glycation End-Products With Cognitive Functions in Individuals With and Without Type 2 Diabetes: The Maastricht Study
Context: Advanced glycation end-products (AGEs) are thought to be involved in the pathogenesis of Alzheimer's disease. AGEs are products resulting from nonenzymatic chemical reactions between reduced sugars and proteins, which accumulate during natural aging, and their accumulation is accelerated in hyperglycemic conditions such as type 2 diabetes mellitus. Objective: The objective of the study was to examine associations between AGEs and cognitive functions. Design, Setting, and Participants: This study was performed as part of the Maastricht Study, a population-based cohort study in which, by design, 215 participants (28.1%) had type 2 diabetes mellitus. Main Outcome Measures: We examined associations of skin autofluorescence (SAF) (n = 764), an overall estimate of skin AGEs, and specific plasma protein-bound AGEs (n = 781) with performance on tests for global cognitive functioning, information processing speed, verbal memory (immediate and delayed word recall), and response inhibition. Results: After adjustment for demographics, diabetes, smoking, alcohol, waist circumference, total cholesterol/high-density lipoprotein cholesterol ratio, triglycerides, and lipid-lowering medication use, higher SAF was significantly associated with worse delayed word recall (regression coefficient, b = - 0.44; P = .04), and response inhibition (b = 0.03; P = .04). After further adjustment for systolic blood pressure, cardiovascular disease, estimated glomerular filtration rate, and depression, associations were attenuated (delayed word recall, b = - 0.38, P = .07; response inhibition, b = 0.02, P = .07). Higher pentosidine levels were associated with worse global cognitive functioning (b = - 0.61; P = .04) after full adjustment, but other plasma AGEs were not. Associations did not differ between individuals with and without diabetes. Conclusion: We found inverse associations of SAF (a noninvasive marker for tissue AGEs) with cognitive performance, which were attenuated after adjustment for vascular risk factors and depression
A molecular signature of epithelial host defense: comparative gene expression analysis of cultured bronchial epithelial cells and keratinocytes
BACKGROUND: Epithelia are barrier-forming tissues that protect the organism against external noxious stimuli. Despite the similarity in function of epithelia, only few common protective mechanisms that are employed by these tissues have been systematically studied. Comparative analysis of genome-wide expression profiles generated by means of Serial Analysis of Gene Expression (SAGE) is a powerful approach to yield further insight into epithelial host defense mechanisms. We performed an extensive comparative analysis of previously published SAGE data sets of two types of epithelial cells, namely bronchial epithelial cells and keratinocytes, in which the response to pro-inflammatory cytokines was assessed. These data sets were used to elucidate a common denominator in epithelial host defense. RESULTS: Bronchial epithelial cells and keratinocytes were found to have a high degree of overlap in gene expression. Using an in silico approach, an epithelial-specific molecular signature of gene expression was identified in bronchial epithelial cells and keratinocytes comprising of family members of keratins, small proline-rich proteins and proteinase inhibitors. Whereas some of the identified genes were known to be involved in inflammation, the majority of the signature represented genes that were previously not associated with host defense. Using polymerase chain reaction, presence of expression of selected tissue-specific genes was validated. CONCLUSION: Our comparative analysis of gene transcription reveals that bronchial epithelial cells and keratinocytes both express a subset of genes that is likely to be essential in epithelial barrier formation in these cell types. The expression of these genes is specific for bronchial epithelial cells and keratinocytes and is not seen in non-epithelial cells. We show that bronchial epithelial cells, similar to keratinocytes, express components that are able to form a cross-linked protein envelope that may contribute to an effective barrier against noxious stimuli and pathogens
Deletion of RAGE fails to prevent hepatosteatosis in obese mice due to impairment of other AGEs receptors and detoxifying systems
Abstract Advanced glycation endproducts (AGEs) are involved in several diseases, including NAFLD and NASH. RAGE is the main receptor mediating the pro-inflammatory signalling induced by AGEs. Therefore, targeting of RAGE has been proposed for prevention of chronic inflammatory diseases. However, the role of RAGE in the development of NAFLD and NASH remains poorly understood. We thus aimed to analyse the effect of obesity on AGEs accumulation, AGE-receptors and AGE-detoxification, and whether the absence of RAGE might improve hepatosteatosis and inflammation, by comparing the liver of lean control, obese (LeptrDb−/−) and obese RAGE-deficient (RAGE−/− LeptrDb−/−) mice. Obesity induced AGEs accumulation and RAGE expression with hepatosteatosis and inflammation in LeptrDb−/−, compared to lean controls. Despite the genetic deletion of RAGE in the LeptrDb−/− mice, high levels of intrahepatic AGEs were maintained accompanied by decreased expression of the protective AGE-receptor-1, impaired AGE-detoxifying system glyoxalase-1, and increased expression of the alternative AGE-receptor galectin-3. We also found sustained hepatosteatosis and inflammation as determined by persistent activation of the lipogenic SREBP1c and proinflammatory NLRP3 signalling pathways. Thus, RAGE targeting is not effective in the prevention of NAFLD in conditions of obesity, likely due to the direct liver specific crosstalk of RAGE with other AGE-receptors and AGE-detoxifying systems
Deletion of RAGE fails to prevent hepatosteatosis in obese mice due to impairment of other AGEs receptors and detoxifying systems
Advanced glycation endproducts (AGEs) are involved in several diseases, including NAFLD and NASH. RAGE is the main receptor mediating the pro-inflammatory signalling induced by AGEs. Therefore, targeting of RAGE has been proposed for prevention of chronic inflammatory diseases. However, the role of RAGE in the development of NAFLD and NASH remains poorly understood. We thus aimed to analyse the effect of obesity on AGEs accumulation, AGE-receptors and AGE-detoxification, and whether the absence of RAGE might improve hepatosteatosis and inflammation, by comparing the liver of lean control, obese (LeptrDb−/−) and obese RAGE-deficient (RAGE−/− LeptrDb−/−) mice. Obesity induced AGEs accumulation and RAGE expression with hepatosteatosis and inflammation in LeptrDb−/−, compared to lean controls. Despite the genetic deletion of RAGE in the LeptrDb−/− mice, high levels of intrahepatic AGEs were maintained accompanied by decreased expression of the protective AGE-receptor-1, impaired AGE-detoxifying system glyoxalase-1, and increased expression of the alternative AGE-receptor galectin-3. We also found sustained hepatosteatosis and inflammation as determined by persistent activation of the lipogenic SREBP1c and proinflammatory NLRP3 signalling pathways. Thus, RAGE targeting is not effective in the prevention of NAFLD in conditions of obesity, likely due to the direct liver specific crosstalk of RAGE with other AGE-receptors and AGE-detoxifying systems
Exercise SBP response and incident depressive symptoms: The Maastricht Study
Objective : An exaggerated exercise SBP, which is potentially modifiable, may be associated with incident depressive symptoms via an increased pulsatile pressure load on the brain. However, the association between exaggerated exercise SBP and incident depressive symptoms is unknown. Therefore, we examined whether exaggerated exercise SBP is associated with a higher risk of depressive symptoms over time. Methods : We used longitudinal data from the population-based Maastricht Study, with only individuals free of depressive symptoms at baseline included (n = 2121; 51.3% men; age 59.5 +/- 8.5 years). Exercise SBP was measured at baseline with a submaximal exercise cycle test. We calculated a composite score of exercise SBP based on four standardized exercise SBP measures: SBP at moderate workload, SBP at peak exercise, SBP change per minute during exercise and SBP 4 min after exercise. Clinically relevant depressive symptoms were determined annually at follow-up and defined as a Patient Health Questionnaire score of at least 10. Results : After a mean follow-up of 3.9 years, 175 participants (8.3%) had incident clinically relevant depressive symptoms. A 1 SD higher exercise SBP composite score was associated with a higher incidence of clinically relevant depressive symptoms [hazard ratio: 1.27 (95% confidence interval: 1.04-1.54)]. Results were adjusted for age, sex, education level, glucose metabolism status, lifestyle, cardiovascular risk factors, resting SBP and cardiorespiratory fitness. Conclusion : A higher exercise SBP response is associated with a higher incidence of clinically relevant depressive symptoms
- …