The peacebuilding potential of technical and vocational education and training programmes in post-conflict Sierra Leone

In peacebuilding contexts unemployed youth are frequently perceived as a high risk for the stability of a country while employed youth are seen as carrying an enormous potential for economic growth. This paper applies a social justice framework (4Rs) in analysing a Business Development (BD) programme that was implemented as part of Sierra Leone’s Technical and Vocational Education and Training (TVET) strategy to promote entrepreneurship development and reduce unemployment among youth. Despite the BD programme’s initial strengths, to recognize youth's heterogeneity with the aim to address some of the root causes of the war, we show how the programme struggled to counter social inequality, unemployment and neopatrimonialism. Sudden decreases in donor funding led to severe modifications of redistribution processes, thereby hampering youth's representation. This raises questions about the design of TVET strategies and BD programmes in post-conflict settings in general. Our paper further showcases how the resurfacing of the root causes of a conflict in the scope of small-scheme development programmes, can have far-reaching effects on young people’s various relationships of trust, if not reconciliation process as a whole

Scales in space

Economists have devoted more attention to the scale of time than to the scale of space. What has been done in the field of space is often general and abstract, not connected to an explicit observation set in time and space. Moreover, time scales and spatial scales are not tied, making the choice for a macro, meso or microeconomic theory a rather arbitrary process. We devote attention to the explanation of the phenomenon of emerging spatial structures. We will discuss the standard economic theories that describe the underlying processes and argue that by being more explicit about spatial scales explanatory power is added to current theoretical work

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

Stability aspects of the traveling salesman problem based on k-best solutions

AbstractThis paper discusses stability analysis for the Traveling Salesman Problem (TSP). For a traveling salesman tour which is known to be optimal with respect to a given instance (length vector) we are interested in determining the stability region, i.e. the set of all length vectors for which the tour is optimal. The following three subsets of the stability region are of special interest: 1.(1) tolerances, i.e. the maximum perturbations of single edges;2.(2) tolerance regions which are subsets of the stability region that can be constructed from the tolerances; and3.(3) the largest ball contained in the stability region centered at the given length vector (the corresponding radius is known as the stability radius). It is well known that the problems of determining tolerances and the stability radius for the TSP are NP-hard so that in general it is not possible to obtain the above-mentioned three subsets without spending a lot of computation time. The question addressed in this paper is the following: assume that not only an optimal tour is known, but also a set of k shortest tours (k ⩾2) is given. Then to which extent does this allow us to determine the three subsets in polynomial time? It will be shown in this paper that having k-best solutions can give the desired information only partially. More precisely, it will be shown that only some of the tolerances can be determined exactly and for the other ones as well as for the stability radius only lower and/or upper bounds can be derived. Since the amount of information that can be derived from the set of k-best solutions is dependent on both the value of k as well as on the specific length vector, we present numerical experiments on instances from the TSPLIB library to analyze the effectiveness of our approach

De bestrijding van geluidshinder

Public Safety Issue

Employment Equity: een Wet bevordering arbeidskansen naar Canadees model

Political Scienc

Are we overusing IVF?

Peer reviewedPublisher PD