6,948 research outputs found
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe
Lipid changes within the epidermis of living skin equivalents observed across a time-course by MALDI-MS imaging and profiling
Ā© 2015 Mitchell et al. Abstract Background: Mass spectrometry imaging (MSI) is a powerful tool for the study of intact tissue sections. Here, its application to the study of the distribution of lipids in sections of reconstructed living skin equivalents during their development and maturation is described. Methods: Living skin equivalent (LSE) samples were obtained at 14 days development, re-suspended in maintenance medium and incubated for 24 h after delivery. The medium was then changed, the LSE re-incubated and samples taken at 4, 6 and 24 h time points. Mass spectra and mass spectral images were recorded from 12 Ī¼m sections of the LSE taken at each time point for comparison using matrix assisted laser desorption ionisation mass spectrometry. Results: A large number of lipid species were identified in the LSE via accurate mass-measurement MS and MSMS experiments carried out directly on the tissue sections. MS images acquired at a spatial resolution of 50 Ī¼m Ć 50 Ī¼m showed the distribution of identified lipids within the developing LSE and changes in their distribution with time. In particular development of an epidermal layer was observable as a compaction of the distribution of phosphatidylcholine species. Conclusions: MSI can be used to study changes in lipid composition in LSE. Determination of the changes in lipid distribution during the maturation of the LSE will assist in the identification of treatment responses in future investigations
Point-contact tunneling spectroscopy measurement of CuTiSe: disorder-enhanced Coulomb effects
We performed point-contact spectroscopy tunneling measurements on
CuTiSe bulk with and at temperatures ranging from
K and observe a suppression in the density of states around zero-bias
that we attribute to enhanced Coulomb interactions due to disorder. We find
that the correlation gap associated with this suppression is related to the
zero-temperature resistivity. We use our results to estimate the disorder-free
transition temperature and find that the clean limit is close to the
experimentally observed .Comment: 4 pages, 4 figure
Lattice dynamics of incommensurate composite Rb-IV and a realization of the monatomic linear chain model
āIt just opens up their worldā: autism, empathy, and the therapeutic effects of equine interactions
Experiences of autism-spectrum disorder are now increasingly studied by social scientists. Humanāanimal relations have also become a major focus of social inquiry in recent years. Examining horse-assisted therapy for autistic spectrum disorders, this is the first paper that brings these fields together. Drawing on participant observation and interviews at a UK horse therapy Centre, this article examines how staff and the parents of riders account for the successes and limitations of equine therapy. To the respondents, horses āopen upā autistic children and make possible interactions that seemed impossible before. Horses were regarded as facilitating the emergence of apparently social behaviours, which included eye contact, pointing, and speech. Three key explanations emerged for therapeutic success: the sensorial, embodied experience of riding the horse; the specific movements and rhythms of the horse; and, the āpersonalityā of the horse. Equine therapy can be regarded as enabling a form of multispecies intersubjectivity, with the resonance between rider and horse seeming to make possible a new attunement between humans. Practices of equine therapy, and perceptions of its efficacy, serve in turn to attune social scientists to a version of empathy constituted through lively and sensorial interactions, as opposed to one that is restricted to particular kinds of humans
Seroepidemiology of group A rotavirus in suburban SĆ£o Paulo, Brazil
Age-specifc patterns of rotavirus infection were investigated using a randomly selected and
representative sample of sera from a suburban community of SĆ£o Paulo, Brazil screened for
class-specifc antibodies to group A rotavirus. Age-serology of anti-rotavirus IgG showed
primary infection predominant in young infants with a median age of around 18 months
consistent with IgM serology suggesting highest rates of recent infection between ages 4 and 48
months. Anti-rotavirus serum IgA prevalence increased gradually with age. Paired samples
from infants, collected 1 month apart, indicated high exposure rates with seroconversion
occurring in several infants during the reported low transmission season. Between 5 and 10%
of adults had elevated IgM levels indicative of recent infection and, potentially, of an
important contribution adults may play to rotavirus transmission. Further understanding of the
dynamics of rotavirus transmission within populations, at group and serotype level, would
benefit the design and monitoring of future immunization programmes
- ā¦