A New Social Conscience

Expecting a generation gap, law student Frederick S. Vondy feels nostalgic--and inspired

Ductility limitations of aluminum-silicon alloys

Relation between microstructure and mechanical properties of cast 356 type aluminum alloy

Academic performance of psychiatrists compared to other specialists before, during, and after medical school.

OBJECTIVE: This study was designed to compare psychiatrists with other physicians on measures of academic performance before, during, and after medical school. METHOD: More than three decades of data for graduates of Jefferson Medical College (N=5,701) were analyzed. Those who pursued psychiatry were compared to physicians in seven other specialties on 18 performance measures. Analysis of covariance was used to control for gender effect. RESULTS: Compared to other physicians, psychiatrists scored higher on measures of verbal ability and general information before medical school and on evaluations of knowledge and skills in behavioral sciences during medical school, but they scored lower on United States Medical Licensing Examinations step 3. CONCLUSIONS: The results generally confirmed the authors\u27 expectations about psychiatrists\u27 academic performance. More attention should be paid to the general medical education of psychiatrists

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Study made of ductility limitations of aluminum-silicon alloys

Study of the relation between microstructure and mechanical properties of aluminum-silicon alloys determines the cause of the variations in properties resulting from differences in solidification rate. It was found that variations in strength are a consequence of variations in ductility and that ductility is inversely proportional to dendrite cell size