First detection of tomato leaf curl New Delhi virus in melon and zucchini squash in southern Italy

In September 2017, severe symptoms and heavy infestations of aleyrodids were reported on cucurbit crops grown in open fields at the border between Apulia and Basilicata regions (southern Italy). In zucchini squash symptoms consisted in severe curling and brittle fracture of the leaves. Melon plants showed bright yellow mosaic on leaves and necrotic streaks along the stems, flower stalks and fruits whereas squash plants displayed severe yellow mosaic and leaf blade deformation. Disease incidence in the three crops was close to 100%. Symptoms resembled those described recently for infections of tomato leaf curl New Delhi virus (ToLCNDV) (Panno et al., 2016) and watermelon mosaic virus (WMV) (Finetti- Sialer et al., 2012). DNA and RNA preparations from two plants for each species were tested by PCR, respectively, with primers For-5’CCCTTGTAAAGTGCAGTCCT3’ and Rev- 5’GGATTTGATGCGTGAGTACA3’ for the AV1 gene of ToLCNDV DNA-A and with primers For-5’AAACTGGG CAGGGTAGCA3’ and Rev-5’TAACCTGCTGTTAA YCCCGCG3’ for the WMV coat protein gene. Samples of melon and zucchini proved positive for ToLCNDV whereas WMV was detected in squash. No amplification products were obtained with primers for squash leaf curl virus, watermelon chlorotic spot virus, cucumber mosaic virus, cucumber vein yellowing virus and zucchini yellow mosaic virus. Amplicon identities were confirmed by sequencing. Those from zucchini and melon showed 100% identity with ToLCNDV from Spain (KF749224) and Sicily (KU145141) whereas those from squash were 99% and 94% identical to WMV from Belgium (KP980663) and Italy (FJ8231229), respectively. The sequence of a 507 bp fragment of ToLCNDV was deposited in GenBank under the accession number MG269826. This is the first report of ToLCNDV in melon and in the continental part of the Country

Intestinal bacterial flora of Mediterranean gilthead sea bream (Sparus aurata Linnaeus) as a novel source of natural surface active compounds

n/

Grafting to Manage Infections of the Emerging Tomato Leaf Curl New Delhi Virus in Cucurbits

Tomato leaf curl New Delhi virus (ToLCNDV) is an emerging begomovirus (Geminiviridae family) listed in the EPPO Alert List 2, present in the Mediterranean area and in Italy, where it was reported in 2015 in Sicilian courgette. The virus is widespread in cucurbits where it causes up to 100% production losses. In 2018, ToLCNDV was isolated in Apulia (southern Italy) in commercial fields of zucchini squash and since then its recurrent outbreaks generated justified concern among growers. Thus, a sustainable and environmentally friendly approach must be adopted. Genetic resistances have been identified in Cucurbita moschata and Luffa cylindrica but, compared to genetic resistance, grafting could provide a faster and more flexible solution because the graft wounding induces tolerance rather than resistance against airborne virus infection. Compared to tolerance, the up-regulation of resistance genes requires energy resources mobilized at the expense of primary metabolism, plant growth, and development. Results of screening among twenty-one local cucurbit cvs. ecotypes and accessions to evaluate tolerance levels against rub-inoculation of ToLCNDV led to the identification of potential rootstocks to attain suitable levels of tolerance against the virus in commercial cucurbit varieties. Cucurbit plants were challenged by a ToLCNDV isolated in Apulia denoted ToLCNDV-Le and evaluated for disease symptoms development and viral DNA accumulation up to 28 days after inoculation. On the basis of disease symptoms developed, plants were classified as tolerant, moderately tolerant, moderately susceptible, and susceptible. Cucumis melo cv. Barattiere did not show any detectable disease symptoms and very low levels of viral DNA accumulation was recorded; thus, it was used as rootstock for some of the remaining cucurbit genotypes that were used as scions. The tolerance trait was transmitted to the otherwise susceptible and moderately susceptible cucurbit genotypes grafted onto the cv. Barattiere. The results of this study suggest practical implications of the approach described

The Role of Grafting in the Resistance of Tomato to Viruses

Grafting is routinely implemented in modern agriculture to manage soilborne pathogens such as fungi, oomycetes, bacteria, and viruses of solanaceous crops in a sustainable and environmentally friendly approach. Some rootstock/scion combinations use specific genetic resistance mechanisms to impact also some foliar and airborne pathogens, including arthropod or contact-transmitted viruses. These approaches resulted in poor efficiency in the management of plant viruses with superior virulence such as the strains of tomato spotted wilt virus breaking the Sw5 resistance, strains of cucumber mosaic virus carrying necrogenic satellite RNAs, and necrogenic strains of potato virus Y. Three different studies from our lab documented that suitable levels of resistance/tolerance can be obtained by grafting commercial tomato varieties onto the tomato ecotype Manduria (Ma) rescued in the framework of an Apulian (southern Italy) regional program on biodiversity. Here we review the main approaches, methods, and results of the three case studies and propose some mechanisms leading to the tolerance/resistance observed in susceptible tomato varieties grafted onto Ma as well as in self-grafted plants. The proposed mechanisms include virus movement in plants, RNA interference, genes involved in graft wound response, resilience, and tolerance to virus infection

Grafting on a non-Transgenic tolerant tomato variety confers resistance to the infection of a sw5-breaking strain of tomato spotted wilt virus via RNA silencing

RNA silencing controls endogenous gene expression and drives defensive reactions against invasive nucleic acids like viruses. In plants, it has been demonstrated that RNA silencing can be transmitted through grafting between scions and silenced rootstocks to attenuate virus and viroid accumulation in the scions. This has been obtained mostly using transgenic plants, which may be a drawback in current agriculture. In the present study, we examined the dynamics of infection of a resistance-breaking strain of Tomato spotted wilt virus (RB-TSWV) through the graft between an old Apulian (southern Italy) tomato variety, denoted Sl-Ma, used as a rootstock and commercial tomato varieties used as scions. In tests with non-grafted plants, Sl-Ma showed resistance to the RB-TSWV infection as viral RNA accumulated at low levels and plants recovered from disease symptoms by 21 days post inoculation. The resistance trait was transmitted to the otherwise highly susceptible tomato genotypes grafted onto Sl-Ma. The results from the analysis of small RNAs hallmark genes involved in RNA silencing and virus-induced gene silencing suggest that RNA silencing is involved in the resistance showed by Sl-Ma against RB-TSWV and in scions grafted on this rootstock. The results from self-grafted susceptible tomato varieties suggest also that RNA silencing is enhanced by the graft itself. We can foresee interesting practical implications of the approach described in this paper

A protocol for producing virus-free artichoke genetic resources for conservation, breeding, and production

The potential of the globe artichoke biodiversity in the Mediterranean area is enormous but at risk of genetic erosion because only a limited number of varieties are vegetatively propagated and grown. In Apulia (southern Italy), the Regional Government launched specific actions to rescue and preserve biodiversity of woody and vegetable crops in the framework of the Rural Development Program. Many globe artichoke ecotypes have remained neglected and unnoticed for a long time and have been progressively eroded by several causes, which include a poor phytosanitary status. Sanitation of such ecotypes from infections of vascular fungi and viruses may be a solution for their ex situ conservation and multiplication in nursery plants in conformity to the current EU Directives 93/61/CEE and 93/62/CEE that enforce nursery productions of virus-free and true-to-type certified stocks. Five Apulian ecotypes, Bianco di Taranto, Francesina, Locale di Mola, Verde di Putignano and Violetto di Putignano, were sanitized from artichoke Italian latent virus (AILV), artichoke latent virus (ArLV) and tomato infectious chlorosis virus (TICV) by meristem-tip culture and in vitro thermotherapy through a limited number of subcultures to reduce the risk of “pastel variants” induction of and loss of earliness. A total of 25 virus-free primary sources were obtained and conserved ex situ in a nursery

VIGS of RDR1 and RDR6 in Sl-Ma and Sl-UC plants.

<p>Relative quantity (RQ) of RDR1 and RDR6 transcripts (columns) in samples of Sl<i>-</i>Ma and Sl<i>-</i>UC plants collected at 14 dpa with <i>A</i>. <i>tumefaciens</i> carrying pTRV1+ pTRV2-RDR1 (Sl-Ma TRV-R1 and Sl-UC TRV-R6) and pTRV1+ pTRV2-RDR6 (Sl-Ma TRV-R1 and Sl-Ma TRV-R6). RQ values were first normalized on the accumulation level of the GAPDH mRNA (Δ cycle threshold [Ct] = Ct_GAPDH–Ct_target RNA) and then used to determine the relative quantification of each target RNA with a calibrator, according to the formula ΔΔCt = ΔCt_calibrator–ΔCt_target RNA. Each target mRNA in an individual mock-inoculated plant served as calibrator (RQ set to 1) for the respective gene. RQ for RDR1 and RDR6 transcripts was deduced by the formula expression 2^-ΔΔCt. Columns represent mean RQ values from three biological replicates and different letters represent statistically significant differences values according to separate one-way ANOVA analysis for each target mRNA, using Tukey’s test (P = 0.05). Vertical bars on columns represent standard deviations among replicates. Figure shows also estimates of the accumulation of TSWV-CiPz RNA (red line) in agroinfiltrated plants. After collection of leaf samples, plants were inoculated with TSWV-CiPZ on the first and second true leaves above remnants of cotyledons and load of viral RNA estimated at 19 dpi with dot blot hybridization. Vertical bars on line represent standard deviations among replicates.</p

Detection of sRNA and mapping on the TSWV-CiPz genome.

<p>(<b>A</b>) silver staining of the total RNA (Total) and the sRNA-enriched preparations (sRNA) extracted from Sl-Ma and Sl-UC plants mock-inoculated (mock) or at 21 dpi with TSWV-CiPz (infected). M is a 100 bp DNA ladder (Promega, Madison, WI, USA). P is a custom 21 bp RNA oligonucleotide used as marker. (<b>B</b>) Northern blots of RNA extracted from purified preparations of TSWV-CiPz and TYRV hybridized with siRNA probes derived from the sRNA-enriched preparations obtained from Sl-Ma and Sl-UC plants mock-inoculated (mock) or at 21 dpi with TSWV-CiPz (infected) (see panel A). (<b>C</b>) ethidium bromide staining of RNA extracted from purified preparations of TSWV-CiPz and TYRV prior to transfer onto nylon membranes, demonstrating equal loading. Hybridization signals of sRNAs labeled with (γ-³²P) ATP with virus genomic RNAs S, M and L pointed by arrows are visible only in RNA preparations from TSWV.</p

Effect of Early Radial Shock Wave Treatment on Spasticity in Subacute Stroke Patients: A Pilot Study

Background. Spasticity is a complication that can start immediately after stroke. Radial extracorporeal shock wave therapy (rESWT) is a physical therapy tool used to manage chronic spasticity. However, the effect of rESWT's early use to treat spasticity after stroke is still not clearly investigated. The aim of this study is to evaluate the efficacy of rESWT in improving poststroke spasticity of the upper limb in patients with a recent onset of spasticity compared to conventional physiotherapy alone. Methods. 40 stroke patients were randomly assigned to experimental (EG) or control group (CG). Both groups underwent two daily sessions of conventional rehabilitation therapy (CRT) 5 days per week; the EG underwent one rESWT session a week for 4 weeks. The modified Ashworth scale (MAS) tested at the shoulder, elbow, and wrist was used as outcome measure. MAS was evaluated at baseline, after 2 and 4 rESWT session, and one month after the last session (follow-up). Results. No significant differences between groups were found at baseline in terms of age, days from onset of spasticity after stroke, and MAS at each body segment. The sample lost eight drop-out patients. Except for the shoulder MAS values, the EG showed statistically significant lower MAS values already after the second rESWT session compared to CG. This significant difference was maintained until the follow-up. The CG showed a significant increase of wrist spasticity after the second evaluation, while the EG maintained constant MAS values throughout the observational period. The elbow spasticity was significantly higher in the CG at the follow-up evaluation. Conclusion. The rESWT combined with CRT seems to be effective in avoiding the increasing progression of spasticity after stroke