7 research outputs found
Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers
In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S- ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E9, B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E9, B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.24525
Analysis of entomogenous fungus Metarhizium anisopliae to control Alphitobius diaperinus in poultry buildings
This present research work has allowed a statistical modeling for conidial adhesion and the potential fungus Metarhizium anisopliae ability to lesser the mealworm Alphitobius diaperinus control, that is an important pest of poultry production, which causes damage to the birds by the development of injuries in the digestion tract, and yet it serves as vector of many avian pathogens. The study of the host cuticle adhesion is very important, whereas the adhesion process represents a complex event, as it is the first occurrence in the pathogen-host cycle, taking place after fungus deposition on the insect, aiming the penetration phase. Adult insects of A. diaperinus were exposed to three concentrations of the fungus: 1x10³, 1x10(6) e 1x10(9) conidia/mL, for 5, 10 and 15 minutes of exposition to each conidial concentration. In order to verify the ability control of M. anisopliae, the insects were forced to the displacement on the conidial mass growth onto PDA medium for 10 minutes, resulting in a 8,1x10(8) conidia/mL inocullum potential, and the mortality was monitored during 21 days, obtaining 74% of mortality in larvae after 48h and 50% of mortality in adults after 15 days, under fungus exposition. ANOVA has showed that there is influence and interaction between both effects: concentration and time.Este trabalho permitiu a construção de um modelo estatístico para a adesão de conídios do fungo Metarhizium anisopliae diante de diferentes níveis de concentração e tempo, além de avaliar seu potencial para o controle do cascudinho (Alphitobius diaperinus), importante praga da avicultura, causadora de danos às aves pelos ferimentos no trato digestivo e pela transmissão de várias doenças. O estudo da adesão sobre o tegumento é de grande importância, pois a adesão representa um evento complexo, sendo o primeiro do ciclo das relações patógeno-hospedeiro que ocorre após a deposição do fungo sobre o inseto e visa a preparação do local para a fase de penetração. Insetos adultos do cascudinho foram expostos a três concentrações do fungo: 1x10³, 1x10(6) e 1x10(9) conídios/mL, sendo 5, 10 e 15 minutos de exposição em cada concentração. Para verificar o potencial de controle de M. anisopliae, os insetos foram colocados para caminhar sobre uma massa de conídios crescida em meio BDA por 10 minutos, resultando num potencial de inóculo de 8,1x10(8) conídios/mL, a mortalidade foi avaliada durante 21 dias consecutivos, onde se verificou uma mortalidade de 74% em larvas após 48h, e 50% de mortalidade em adultos após 15 dias de exposição ao fungo. A análise de variância (ANOVA) mostrou que existe influência e interação de ambos os efeitos: concentração e tempo
Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers
not available
No presente trabalho estudou-se a performance da linhagem E9 durante um processo de armazenamento, no qual conídios foram mantidos à -20°C com glicerol e sem glicerol. Esta linhagem foi alvo desse estudo por ser amplamente utilizada em nosso laboratório e por diversos laboratórios brasileiros, servindo como referência em estudos sobre entomopatógenos. Nestas condições os objetivos foram estimar as características do fungo quanto à evolução de O2, a variação na viabilidade determinada pela capacidade germinativa dos conídios, e a expressão de virulência, durante o processo. Na avaliação da evolução de O2, testes de respirometria foram realizados, utilizando-se a glicose como única fonte de carbono em um meio de cultivo simplificado. A virulência foi testada em bioensaios realizados com ninfas de 3 e 4 estágios do vetor da doença de Chagas Panstrongylus megistus; e a viabilidade foi obtida comparando-se conídios germinados e não germinados. Os resultados obtidos mostraram a necessidade de uma melhor compreensão, para que estes testes realizados se interajam mais efetivamente, pois foi observado que os dados relativos a viabilidade e o quociente de oxigênio (Q O2) do fungo isoladamente, não fornecem subsídios suficientes para se avaliar a capacidade entomopatogênica de uma dada linhagem. A ação do glicerol como crioprotetor, não foi eficiente no sentido de se representar diferenças significativas com relação à performance do entomopatógeno, uma vez que os valores de LT50 não foram muito divergentes.not availabl
Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers
In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S- ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E9, B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E9, B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae