Vaccine development in Staphylococcus aureus: taking the biofilm phenotype into consideration

Vaccine development against pathogenic bacteria is an imperative initiative as bacteria are gaining resistance to current antimicrobial therapies and few novel antibiotics are being developed. Candidate antigens for vaccine development can be identified by a multitude of high-throughput technologies that were accelerated by access to complete genomes. While considerable success has been achieved in vaccine development against bacterial pathogens, many species with multiple virulence factors and modes of infection have provided reasonable challenges in identifying protective antigens. In particular, vaccine candidates should be evaluated in the context of the complex disease properties, whether planktonic (e.g. sepsis and pneumonia) and/or biofilm associated (e.g. indwelling medical device infections). Because of the phenotypic differences between these modes of growth, those vaccine candidates chosen only for their efficacy in one disease state may fail against other infections. This review will summarize the history and types of bacterial vaccines and adjuvants as well as present an overview of modern antigen discovery and complications brought about by polymicrobial infections. Finally, we will also use one of the better studied microbial species that uses differential, multifactorial protein profiles to mediate an array of diseases, Staphylococcus aureus, to outline some of the more recently identified problematic issues in vaccine development in this biofilm-forming species

Stably luminescent Staphylococcus aureus clinical strains for use in bioluminescent imaging.

In vivo bioluminescent imaging permits the visualization of bacteria in live animals, allowing researchers to monitor, both temporally and spatially, the progression of infection in each animal. We sought to engineer stably luminescent clinical strains of Staphylococcus aureus, with the goal of using such strains in mouse models. The gram-positive shuttle vector pMAD was used as the backbone for an integration plasmid. A chloramphenicol resistance gene, a modified lux operon from Photorhabdus luminescens, and approximately 650 bp of homology to the chromosome of the USA300 S. aureus strain NRS384 were added, generating plasmid pRP1195. Electroporation into strain RN4220 followed by temperature shift led to integration of pRP1195 into the chromosome. The integrated plasmid was transferred to clinical strains by phage transduction. Luminescent strains displayed no in vitro growth defects. Moreover, luminescence was stable in vitro after three rounds of subculture over 48 hours of growth in the absence of antibiotics. Mice were infected with a luminescent strain of NRS384 in skin and intravenous models. In a mouse skin model, luminescent bacteria were present in lesions that formed and cleared over the course of several days, and in an intravenous model, bacteria inoculated in the mouse tail vein were observed spreading to multiple tissues. No statistically significant difference in virulence was observed between NRS384 and the luminescent strain in either infection model. These preliminary data suggest that this luminescent USA300 strain is suitable for use in mouse models. Similar strains were engineered using other sequenced clinical strains. Because these strains are stably luminescent, they should prove useful in animal models of infection

Murine Immune Response to a Chronic Staphylococcus aureus Biofilm Infection ▿ †

Staphylococcus aureus has reemerged as an important human pathogen in recent decades. Although many infections caused by this microbial species persist through a biofilm mode of growth, little is known about how the host's adaptive immune system responds to these biofilm infections. In this study, S. aureus cells adhered to pins in culture and were subsequently inserted into the tibiae of C57BL/6 mice, with an infecting dose of 2 × 105 CFU. This model was utilized to determine local cytokine levels, antibody (Ab) function, and T cell populations at multiple time points throughout infection. Like human hosts, S. aureus implant infection was chronic and remained localized in 100% of C57BL/6 mice at a consistent level of approximately 107 CFU/gram bone tissue after day 7. This infection persisted locally for >49 days and was recalcitrant to clearance by the host immune response and antimicrobial therapy. Local inflammatory cytokines of the Th1 (interleukin-2 [IL-2], IL-12 p70, tumor necrosis factor alpha [TNF-α], and IL-1β) and Th17 (IL-6 and IL-17) responses were upregulated throughout the infection, except IL-12 p70, which dwindled late in the infection. In addition, Th1 Ab subtypes against a biofilm antigen (SA0486) were upregulated early in the infection, while Th2 Abs and anti-inflammatory regulatory T cells (Tregs) were not upregulated until later. These results indicate that early Th1 and Th17 inflammatory responses and downregulated Th2 and Treg responses occur during the development of a chronic biofilm implant infection. This unrestrained inflammatory response may cause tissue damage, thereby enabling S. aureus to attach and thrive in a biofilm mode of growth

PCR analysis of plasmid integration.

<p>Primers specific for pRP1195 and chromosomal sequences were used in PCR reactions with chromosomal DNA from SAP231 (integrant) and NRS384 (WT) as templates. Primers used were: C1, (GCATGCCATTTTCTTTATCATAAGTG); C2, (CAGTTATGGTGGTCTTATAGAGAGAC); P1, (CAGTCAGAGGAGCGCCGACAACACC); P2, (TTTCGTTTGTTGAACTAATGGGTGC). Molecular weight in kilobases is indicated on the left.</p

Plasmids and strains used in this work.

<p>Plasmids and strains used in this work.</p

Analysis of <i>in vitro</i> growth.

<p>A) <i>In vitro</i> growth curves. Strains were grown overnight in TSB with (luminescent strains) or without (parental strains) 10 µg/ml chloramphenicol and subcultured at a dilution of 1∶100 in TSB without antibiotic. MW2-Lux, SAP227; Newman-Lux, SAP229; NRS384-Lux, SAP231. B) Luminescence after <i>in vitro</i> outgrowth. SAP231 was grown in TSB and subcultured three times over the course of 48 h. Serial dilutions were plated on TSA in the absence of antibiotics, and plates were imaged as described in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0059232#s4" target="_blank">Materials and Methods</a>.</p

Map of integrative plasmid pRP1195.

<p>Features added to the pMAD backbone as described in <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0059232#s4" target="_blank">Materials and Methods</a> include: <i>cm</i>, chloramphenicol resistance gene; homology, PCR fragment in the area of pseudogene USA300_HOU1102 amplified from NRS384; LuxB, A, D, C, and E, modified <i>lux</i> operon from <i>Photorhabdus luminescens</i>.</p

BALB/c intravenous infection with wild-type or luminescent NRS384.

<p>In an intravenous model, mice were injected via the tail vein with either the wild-type USA300 strain (NRS384) or the luminescent strain (SAP149). Mice injected with the luminescent strain were imaged over the course of 6d (A); images are representative. There was no statistically significant difference in survival of mice injected with the two strains (B) by either the log-rank (Mantel-Cox) Test (<i>P</i> = 0.46) or the Gehan-Breslow-Wilcoxon Test (<i>P</i> = 0.68); n = 20 mice per group.</p

Evaluation of genetically inactivated alpha toxin for protection in multiple mouse models of Staphylococcus aureus infection.

Staphylococcus aureus is a major human pathogen and a leading cause of nosocomial and community-acquired infections. Development of a vaccine against this pathogen is an important goal. While S. aureus protective antigens have been identified in the literature, the majority have only been tested in a single animal model of disease. We wished to evaluate the ability of one S. aureus vaccine antigen to protect in multiple mouse models, thus assessing whether protection in one model translates to protection in other models encompassing the full breadth of infections the pathogen can cause. We chose to focus on genetically inactivated alpha toxin mutant HlaH35L. We evaluated the protection afforded by this antigen in three models of infection using the same vaccine dose, regimen, route of immunization, adjuvant, and challenge strain. When mice were immunized with HlaH35L and challenged via a skin and soft tissue infection model, HlaH35L immunization led to a less severe infection and decreased S. aureus levels at the challenge site when compared to controls. Challenge of HlaH35L-immunized mice using a systemic infection model resulted in a limited, but statistically significant decrease in bacterial colonization as compared to that observed with control mice. In contrast, in a prosthetic implant model of chronic biofilm infection, there was no significant difference in bacterial levels when compared to controls. These results demonstrate that vaccines may confer protection against one form of S. aureus disease without conferring protection against other disease presentations and thus underscore a significant challenge in S. aureus vaccine development

Epicutaneous model of community-acquired Staphylococcus aureus skin infections.

Staphylococcus aureus is one of the most common etiological agents of community-acquired skin and soft tissue infection (SSTI). Although the majority of S. aureus community-acquired SSTIs are uncomplicated and self-clearing in nature, some percentage of these cases progress into life-threatening invasive infections. Current animal models of S. aureus SSTI suffer from two drawbacks: these models are a better representation of hospital-acquired SSTI than community-acquired SSTI, and they involve methods that are difficult to replicate. For these reasons, we sought to develop a murine model of community-acquired methicillin-resistant S. aureus SSTI (CA-MRSA SSTI) that can be consistently reproduced with a high degree of precision. We utilized this model to begin to characterize the host immune response to this type of infection. We infected mice via epicutaneous challenge of the skin on the outer ear pinna using Morrow-Brown allergy test needles coated in S. aureus USA300. When mice were challenged in this model, they developed small, purulent, self-clearing lesions with predictable areas of inflammation that mimicked a human infection. CFU in the ear pinna peaked at day 7 before dropping by day 14. The T(h)1 and T(h)17 cytokines gamma interferon (IFN-γ), interleukin-12 (IL-12) p70, tumor necrosis factor alpha (TNF-α), IL-17A, IL-6, and IL-21 were all significantly increased in the draining lymph node of infected mice, and there was neutrophil recruitment to the infection site. In vivo neutrophil depletion demonstrated that neutrophils play a protective role in preventing bacterial dissemination and fatal invasive infection. Infect Immun 2013 Apr; 81(4):1306-131