Expresión de TSHβ y del polimorfismo D2THr92ala en el gen de la deiodinasa 2 en pacientes gestantes con patologías tiroideas del Hospital Materno Perinatal “Mónica Pretelini Sáenz”.

Las enfermedades tiroideas son patologías que con frecuencia afectan a las mujeres embarazadas causando complicaciones graves. La investigación actual tiene como objetivo averiguar si la expresión del gen TSHβ variante X1 (TSHβX1) y el polimorfismo D2 Thr92Ala del gen DIO2 pueden estar involucrados en el desarrollo y la evolución de la enfermedad tiroidea en mujeres gestantes mexicanas. Fue un estudio comparativo, prospectivo, clínico y transversal con 96 pacientes embarazadas de un hospital obstétrico mexicano, 38 de ellas eran normo tiroideas y 54 tenían enfermedad tiroidea. La expresión de TSHβX1 se cuantificó mediante PCR en tiempo real y la presencia del polimorfismo D2 Thr92Ala se verificó a través de genotipificación con sonda TaqMan. Además, se correlacionaron los valores de TSH, creatinina, triglicéridos, colesterol, glucosa y hemoglobina de los pacientes con los hallazgos genéticos. Se observó que no había relación entre el historial de abortos y el estado de salud de las pacientes, pero sí con los antecedentes familiares de enfermedad tiroidea. No hubo relación entre los parámetros bioquímicos y las características genéticas, pero se observaron casos metabólicamente típicos de la enfermedad tiroidea con complicaciones externas en otros sistemas. Se confirmó la expresión de TSHβX1, pero ésta no se vio relacionada con la enfermedad tiroidea. El genotipo más común en la población analizada fue CC, y estuvo relacionado con la presentación de enfermedad tiroidea. Los dos hallazgos en el estudio ayudan a la caracterización de la población mexicana, porque son hallazgos nuevos

La placenta como órgano endocrino compartido y su acción en el embarazo normoevolutivo

La placenta es el órgano más especializado implicado en el embarazo, que gracias a su compleja estructura y con la ayuda del líquido amniótico ayuda al crecimiento y desarrollo del feto en formación, siendo los cambios presentados en ella factores de alto impacto en el desarrollo intrauterino fetal. Teniendo en cuenta su relevancia en el embarazo, la placenta ha sido estudiada como parte de la etiología de condiciones gestacionales severas como la preeclampsia y el retraso en el crecimiento intrauterino (RCIU), en los cuales se ha encontrado la relación de los procesos placentarios con su desarrollo.La placenta humana cumple desde funciones de trasporte de nutrientes, respiración, y eliminación de desechos, hasta la función endocrina que alberga los efectos más importantes para la evolución y manutención de un embarazo normal, siendo una falla en dichas funciones, el desencadenante de patologías como la preeclampsia y el retraso en el crecimiento intrauterino (RCIU). Se destacan por su importancia hormonas como la gonadotropina coriónica humana (hCG), el lactógeno placentario humano (hPL), las hormonas tiroideas y las esteroideas, destacándose en estas últimas los mecanismos que se conjugan para su producción. Cabe destacar que en cuanto a las funciones endocrinas, si bien la placenta produce algunas hormonas por sí sola, no es órgano completamente independiente e involucra varios ejes hipotalámicos maternos para poder funcionar de una manera correcta, producir lo que se necesita, y contribuir a que la gestación llegue a un feliz término

Genetics of Thyroid Disorders

Background: Thyroid diseases are the most common endocrine pathologies second to diabetes. They have been shown to have high genetic impact, and variants in any of the genes involved in the metabolism of thyroid hormones have marked influence on the development of these diseases. Aim: To identify the genes that have been most involved in the development of thyroid pathologies by reviewing the literature with recent relevant articles. Materials and methods: We performed a literature search on the NCBI (National Center for Biotechnology Information) databases, and that of the European Bioinformatics Institute (EMBL-EBI) using keywords related to the topic of interest). Results: Activation of oncogenes such as RAS, BRAF, RET/PTC and the overstimulation of the PI3K/AKT pathway plays an important role in thyroid tumorigenesis. SLC5A5, SLC26A4, TG, TPO, DUOX2, DUOXA2 are related to hypothyroidism. Risk factors for Graves’ disease are associated with the presence of HLA-DR3, CTLA4, PTPN22, CD40, IL2RA (CD25), FCRL3, and IL23R. FOXE1 can be associated to hypothyroidism and papillary thyroid cancer. Conclusions: Thyroid diseases are polygenetic, and while there are sufficient pathways affected by genetic changes, and there is, to our knowledge, no gene that has been found to be specifically causal, and the pathology has been the result of the interaction of many genetic variables such as polymorphisms or mutations

TSHβX1 splice variant expression and D2 Thr92Ala polymorphism analysis in pregnant women with thyroid diseases

Thyroid diseases are pathologies that frequently affect pregnant women. The objective was to find out whether the expression of TSHβX1 splice variant and D2 Thr92Ala polymorphism in the DIO2 gene are associated with thyroid disease in pregnant women. It was a comparative, prospective clinical, and cross-sectional study. Ninety-two pregnant patients, of which 38 were normothyroid and 54 had thyroid disease, were included. The expression of the TSHβX1 splice variant was quantified by real-time PCR and the D2 Thr92Ala (rs225014 CT) polymorphism was genotyped using TaqMan probes. The TSHβX1 splice variant was detected in both groups without significant differences in the relative expression. The T allele was associated with the thyroid dysfunction (OR = 2.117, p = 0.0339). We confirmed the presence of the predicted TSHβX1, and our results suggest that 92Thr (rs225017T) allele is a risk factor to thyroid dysfunction in pregnant women

Pancreatic Duodenal Homeobox Factor-1 and Neurogenin-3 Serum Expression in Gestational Diabetes

Objectives: Pancreatic duodenal homeobox factor-1 (PDX-1) and neurogenin-3 (NGN-3) are progenitor cell markers in the pancreas. The aim was to compare their serum levels in women with and without gestational diabetes mellitus (GDM). Material and Methods: This prospective, cross-sectional study included two groups: (a) Women with normal gestation and (b) with GDM. PDX-1 and NGN-3 serum expression was determined by qRT-PCR. Student’s t-test or the Mann–Whitney U-test was used to contrast both groups and the Pearson or Spearman correlation was used. A multiple regression was done introducing body mass index and the relative expression of both genes as independent variables and glucose as dependent variable. Statistical significance was tested at P ≤ 0.05 level. Results: Thirty-eight patients (mean age was of 29.00 ± 7.74 years) were included, 22 belonged to the normal pregnancies, and 16 to GDM. Using the ΔΔCt method, the expression fold change for PDX-1 was 0.458 and for NGN-3 it was 0.361. There was a significant positive correlation between the expressions of both genes. The multiple regression was significant for both genes expression and glucose levels in case of having normal weight. Conclusion: PDX-1 and NGN-3 low serum expression could be predictors of higher glucose levels in normal pregnancie

Serum Homocysteine Levels and its Methylenetetrahydrofolate Gene (MTHFR) C677t Polymorphism in Patients with Hemodialysis

Homocysteine plays an important role in cardiovascular disease as an independent risk factor, especially in patients with renal insufficiency. The present study aimed to determine whether Hcy levels, or those of its C677T polymorphism, were associated with higher mortality in patients submitted to chronic hemodialysis treatment. This was a descriptive, prospective study. Chronic renal patients undergoing hemodialysis in the "General Hospital, ISSSTE" Dr. Darío Fernández Fierro, Mexico City were included in the study. Serum homocysteine was analyzed by means of an ELISA test. The primers utilized for MTHFR C677T polymorphism identification were the following: F: 5'TGAAGGAGAAGGTGTCTGCGGGA3', R: 5'AGGACGGTGCGGTGAGTG3' and F2: 5’GCAGGGAGCTTTGAGGCTGAC3’. Differences among nominal conditions were evaluated by the Mann-Whitney U-test. Spearman test was used for correlation among variables. Regression, log-linear analysis and receiver operating characteristic (ROC) curves were conducted to evaluate the possible influence on prognosis of Hcy levels and the presence of the MTHFR C677T polymorphism. Cox regression and Kaplan-Meier tests were performed to evaluate the Hcy levels influence on survival. In all cases, p<0.05 was considered statistically significant. All tests were performed with the SPSS ver. 23 statistical software program. By means of regression analysis (p = 0.046) and ROC curve age was the sole significant prognostic variable for the "death". The loglinear analysis did not show any association between the presence of MTHFR C677T SNP with the mortality of patients. It was concluded that Hcy levels and the presence/absence of MTHFR C677T are not stronger predictors for mortality than the traditional cardiovascular risk factors."Dr. Darío Fernández Fierro" General Hospital. Ciprés Grupo Médico S.C. (CGM)

Diccionario De Términos Contables

Tesis en Pasta Encuadernada de Color Azul y CDPregradoContador(a) Público(a