7 research outputs found
Molecular recognition of T:G mismatched Base Pairs in DNA studied by Electrospray Ionization Mass Spectrometry
TG mismatched base pairs in DNA are responsible for most of the common mutations leading to formation of tumors in humans. TG mismatches are particularly abundant in cells lacking mismatch repair mechanism (MMR). MMR deficiency increases 50-1000-fold spontaneous mutation rates (microsatellite instability MSI). An increase of MSI is observed in hereditary nonpolyposis colon cancer (HNPCC) and in a series of sporadic tumor types. In addition, MMR deficiency can lead to resistance to several chemotherapeutic agents (DNA damaging agent). The aim of the present work is the development and validation of an ESI-MS screening method for the identification of new molecules able to recognize TG mismatched base pairs in DNA. This would help in the synthesis of new chemotherapeutic agents particularly effective on MMR deficient cell lines.
ESI MS spectra were recorded on a Q-Tof Ultima mass spectrometer (Waters, Manchester UK) with negative ion detection by continuous infusion at 5 uL/min. Experiments performed on mixture of ligands, whereas resolving power above 10,000 are required, were carried out on a LTQ-Orbitrap (Thermo Fisher Scientific, Bremen, Germany). Different self complementary DNA sequence were synthesized. The duplex fully matched sequence (HFM) was formed from the single strand d(GAACCGGTTC) and was used as control. A duplex DNA structure incorporating two T:G mismatched base pairs (HDM) were obtained from the sequence d(GAACTGGTTC). Since a tandem T:G/G:T mismatch is seldom found in vivo, an hairpin DNA sequence (HSM) d(GAACTGGTCCTCTGACTGGTTC) bearing a single T:G mismatch was prepared. A poliAT DNA duplex (A5TG) d(ACCTTTTTGATGT) was also tested. Solutions of oligonucleotides were heated to 90°C for 5 min and cooled to room temperature overnight to form duplexes.
Different papers confirm that the duplex DNA structure is maintained in the gas phase and the Watson-Crick base pairing is preserved [1,2]. In our study the formation of duplexes was confirmed by ESI-MS and dissociation curves were obtained for the different oligonucleotides confirming a decreasing stability of the duplexes when TG mismatches are present. This hairpin DNA was used to set up the method for studying the complexes formed with minor groove binders and intercalators (doxorubicin). The association constants (Kas) were directly determined from the MS spectrum following a procedure developed by Rosu et all. [3]. Different standard compounds were tested against the three DNA targets at 5 and 25 uM (HFM; HSM; A5TG). The amount of bound ligand was used to determine the selectivity of a binder among the different DNA sequences [4]. As expected the minor groove binders (Distamycin A, H33258, H33342, DAPI) show an evident selectivity for the poliAT sequence A5TG and a poor affinity for the DNA sequence bearing a single mismatch (HSM).
Intercalator doxorubicin did not show any selectivity between the Hairpin Single Mismatch (HSM) and A5TG. Different Lexitropsin derivatives, able to recognize single and double mismatches, were designed, synthesized and tested with this procedure. NMS-077 reveals a significant selectivity for the Hairpin Single mismatch and the ligand binds with positive cooperativity Ka1<4Ka2.
[1] P.D. Schnier, J.S. Klassen, E.F. Strittmatter, E.R. Williams, J. Am. Chem. Soc. 120 (1998) 9605
[2] V. Gabelica, E. De Pauw, Int. J. Mass Spectrom 219 (2002) 151
[3] F. Rosu, V. Gabelica, C. Hossier, E. De Pauw, Nucleic Acid Res 30/16 (2002) e82
[4] F. Rosu, E. De Pauw , V. Gabelica, Biochimie 90(7) (2008) 107
Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA
The DNA alkylating mechanism of PNU-
159682 (PNU), a highly potent metabolite of the anthracycline
nemorubicin, was investigated by gel-electrophoretic,
HPLC-UV, and micro-HPLC/mass spectrometry (MS)
measurements. PNU quickly reacted with double-stranded
oligonucleotides, but not with single-stranded sequences, to
form covalent adducts which were detectable by denaturing
polyacrylamide gel electrophoresis (DPAGE). Ion-pair reversephase
HPLC-UV analysis on CG rich duplex sequences having
a 5\u2032-CCCGGG-3\u2032 central core showed the formation of two
types of adducts with PNU, which were stable and could be
characterized by micro-HPLC/MS. The first type contained
one alkylated species (and possibly one reversibly bound
species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective
bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical
anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence
containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG\ub7CGCGTA) pointed
out the importance of guanine sequence context in modulating DNA alkylation
Mass Spectrometric Strategies for the Identification and Characterization of Human Serum Albumin Covalently Adducted by Amoxicillin: <i>Ex Vivo</i> Studies
This
study addresses the detection and characterization of the
modification of human serum albumin (HSA) by amoxicillin (AX) in <i>ex vivo</i> samples from healthy subjects under oral amoxicillin
administration (acute intake of 1 g every 8 h for 48 h). To reach
this goal, we used an analytical strategy based on targeted and untargeted
mass spectrometric approaches. Plasma samples withdrawn before AX
oral intake represented the negative control samples to test the method
selectivity, whereas HSA incubated <i>in vitro</i> with
AX was the positive control. Different MS strategies were developed,
particularly (1) multiple reaction monitoring (MRM) and precursor
ion scan (PIS) using a HPLC system coupled to a triple quadrupole
MS analyzer and (2) a dedicated data-dependent scan and a customized
targeted MS/MS analysis carried out using a nano-LC system coupled
to a high-resolution MS system (LTQ Orbitrap XL). Lys 190 was identified
as the only modification site of HSA in the <i>ex vivo</i> samples. The AX adduct was identified and fully characterized by
complementary targeted approaches based on triple quadrupole (MRM
mode) and orbitrap (SIC mode) mass analyzers. The SIC mode also permitted
the relative amount of AX-adducted HSA to be measured, ranging from
1 to 2% (6â12 ÎŒM) at 24 and 48 h after the oral intake.
No adduct in any <i>ex vivo</i> sample was identified by
the untargeted methods (PIS and data-dependent scan mode analysis).
The results on one hand indicate that MS, in particular high-resolution
MS, analysis represents a suitable analytical tool for the identification/characterization
of covalently modified proteins/peptides; on the other hand, they
give deeper insight into AX-induced protein haptenation, which is
required to better understand the mechanisms involved in AX-elicited
allergic reactions
Thieno[3,2-c]pyrazoles: A novel class of Aurora inhibitors with favorable antitumor activity
A novel series of 3-amino-1H-thieno[3,2-c]pyrazole derivatives demonstrating high potency in inhibiting Aurora kinases was developed. Here we describe the synthesis and a preliminary structureâactivity relationship, which led to the discovery of a representative compound (38), which showed low nanomolar inhibitory activity in the anti-proliferation assay and was able to block the cell cycle in HCT-116 cell line. This compound demonstrated favorable pharmacokinetic properties and good efficacy in the HL-60 xenograft tumor model
Discovery of 2-[1-(4,4-Difluorocyclohexyl)piperidin-4-yl]-6-fluoro-3-oxo-2,3-dihydro-1H-isoindole-4-carboxamide (NMS-P118):a potent, orally available, and highly selective PARP-1 inhibitor for cancer therapy
The
nuclear protein polyÂ(ADP-ribose) polymerase-1 (PARP-1) has a well-established
role in the signaling and repair of DNA and is a prominent target
in oncology, as testified by the number of candidates in clinical
testing that unselectively target both PARP-1 and its closest isoform
PARP-2. The goal of our program was to find a PARP-1 selective inhibitor
that would potentially mitigate toxicities arising from cross-inhibition
of PARP-2. Thus, an HTS campaign on the proprietary Nerviano Medical
Sciences (NMS) chemical collection, followed by SAR optimization,
allowed us to discover 2-[1-(4,4-difluorocyclohexyl)Âpiperidin-4-yl]-6-fluoro-3-oxo-2,3-dihydro-1<i>H</i>-isoindole-4-carboxamide (NMS-P118, <b>20by</b>).
NMS-P118 proved to be a potent, orally available, and highly selective
PARP-1 inhibitor endowed with excellent ADME and pharmacokinetic profiles
and high efficacy in vivo both as a single agent and in combination
with Temozolomide in MDA-MB-436 and Capan-1 xenograft models, respectively.
Cocrystal structures of <b>20by</b> with both PARP-1 and PARP-2
catalytic domain proteins allowed rationalization of the observed
selectivity
2022 White Paper on Recent Issues in Bioanalysis: ICH M10 BMV Guideline & Global Harmonization; Hybrid Assays; Oligonucleotides & ADC; Non-Liquid & Rare Matrices; Regulatory Inputs (Part 1A - Recommendations on Mass Spectrometry, Chromatography and Sample Preparation, Novel Technologies, Novel Modalities, and Novel Challenges, ICH M10 BMV Guideline & Global Harmonization Part 1B - Regulatory Agencies' Inputs on Regulated Bioanalysis/BMV, Biomarkers/CDx/BAV, Immunogenicity, Gene & Cell Therapy and Vaccine).
The 16th Workshop on Recent Issues in Bioanalysis (16th WRIB) took place in Atlanta, GA, USA on September 26-30, 2022. Over 1000 professionals representing pharma/biotech companies, CROs, and multiple regulatory agencies convened to actively discuss the most current topics of interest in bioanalysis. The 16th WRIB included 3 Main Workshops and 7 Specialized Workshops that together spanned 1 week in order to allow exhaustive and thorough coverage of all major issues in bioanalysis, biomarkers, immunogenicity, gene therapy, cell therapy and vaccines. Moreover, in-depth workshops on the ICH M10 BMV final guideline (focused on this guideline training, interpretation, adoption and transition); mass spectrometry innovation (focused on novel technologies, novel modalities, and novel challenges); and flow cytometry bioanalysis (rising of the 3rd most common/important technology in bioanalytical labs) were the special features of the 16th edition. As in previous years, WRIB continued to gather a wide diversity of international, industry opinion leaders and regulatory authority experts working on both small and large molecules as well as gene, cell therapies and vaccines to facilitate sharing and discussions focused on improving quality, increasing regulatory compliance, and achieving scientific excellence on bioanalytical issues. This 2022 White Paper encompasses recommendations emerging from the extensive discussions held during the workshop and is aimed to provide the bioanalytical community with key information and practical solutions on topics and issues addressed, in an effort to enable advances in scientific excellence, improved quality and better regulatory compliance. Due to its length, the 2022 edition of this comprehensive White Paper has been divided into three parts for editorial reasons. This publication (Part 1A) covers the recommendations on Mass Spectrometry and ICH M10. Part 1B covers the Regulatory Agencies' Inputs on Bioanalysis, Biomarkers, Immunogenicity, Gene & Cell Therapy and Vaccine. Part 2 (LBA, Biomarkers/CDx and Cytometry) and Part 3 (Gene Therapy, Cell therapy, Vaccines and Biotherapeutics Immunogenicity) are published in volume 15 of Bioanalysis, issues 15 and 14 (2023), respectively
Alkylsulfanyl-1,2,4-triazoles, a New Class of Allosteric Valosine Containing Protein Inhibitors. Synthesis and StructureâActivity Relationships
Valosine containing protein (VCP), also known as p97,
is a member
of AAA ATPase family that is involved in several biological processes
and plays a central role in the ubiquitin-mediated degradation of
misfolded proteins. VCP is an ubiquitously expressed, highly abundant
protein and has been found overexpressed in many tumor types, sometimes
associated with poor prognosis. In this respect, VCP has recently
received a great deal of attention as a potential new target for cancer
therapy. In this paper, the discovery and structureâactivity
relationships of alkylsulfanyl-1,2,4-triazoles, a new class of potent,
allosteric VCP inhibitors, are described. Medicinal chemistry manipulation
of compound <b>1</b>, identified via HTS, led to the discovery
of potent and selective inhibitors with submicromolar activity in
cells and clear mechanism of action at consistent doses. This represents
a first step toward a new class of potential anticancer agents