The methodology of food design. Part 2. Digital nutritiology in personal food

Atherosclerosis (the main cause of a wide range of cardiovascular diseases) and other multifactorial diseases depend on several nutrition factors, defined in general by lifestyle that directly and constantly affects the human body. The modern level of science and technology development is able to form a diet, taking into account all personal characteristics in such a way that makes nutrition an effective preventive measure against diseases in order to keep a person healthy. The purpose of this article is to define and study all the limitations (the scope of its coverage in the scientific literature) that arose in the process of research aimed to formation of an integrated personal approach to designing of nutrition to prevent atherosclerosis. The object of the study was scientific literature, which is available in open source and free access databases: PubMed, ScienceDirect, eLIBRARY.RU, www.fips.ru, Patentscope. The language of search is Russian and English, search depth is 12 years. In the course of the research two food design concepts were found that affect process of digitalization in the food sector: the concept “FoodTech” (food technology) and digital nutritiology. It was established that in Russia only one company — LLC “City Supermarket” (Moscow), that works with the brand “Azbuka Vkusa” — acts in the sphere of “FoodTech” on the Russian market. This company selects personalized food, taking into account the results of personal nutrigenetic tests, in cooperation with LLC “Genotech” (Moscow). There is a need to use biological information, statistical information processing (nutrigenetic studies, nutrigenomic research) and machine-aided data processing (machine learning) for further generation of automatic algorithm that compiles personal recommendations. The relevance of generation of a national domestic database on chemical composition of food products (presented in the market) to simplify the preparation of individual personal diets is observed. We underline the necessity to use the test-organisms, i. e. dorio fish / zebrafish (Danio rerio) and nematodes (Caenorhabditis elegans)), which were used to determine the activity of candidate substances — the biologically active substances that feature antiatherosclerotic properties. In the future the authors plan to conduct a nutrigenomic and nutrigenetic study, using digital achievements. To collect information about consumers, it is necessary to apply digital devices, and use biological informatics to process the results; after that it is necessary to generate the algorithm for automatic selection of personalized dietary recommendations

ИССЛЕДОВАНИЕ И РАЗРАБОТКА МЕТОДА КОНТРОЛЯ ПАТОГЕННЫХ ПРИОННЫХ ИНФЕКЦИЙ ПОБОЧНОГО СЫРЬЯ МЯСНОЙ ПРОМЫШЛЕННОСТИ

Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries) revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail). The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left) and CAGTTTCGATCCTCCTCCAG (right) primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.Разработан высокочувствительный и специфичный метод идентификации патогенного прионного белка. Установлено, что фракции водорастворимых белков говядины и плазмы крови сельскохозяйственных животных являются нормальными прионными белками крупного рогатого скота. Выравнивание последовательностей гена  патогенного и нормального прионного белка Ovisaries, показало, что нуклеотидные последовательности PrPc и PrPsc являются идентичными. Выбрано мышиное моноклональное антитело 15В3. Построена синтетическая последовательность, дли-ной 194 п.н., полученная случайным образом (ДНК-хвост). Созданная последовательность и последовательности базы данных гомологов не имеют. К синтезированному ДНК-хвосту подобраны 2 праймера размерами 20 п.н. Полученныеэкспериментальные данные указывают на то, что при использовании праймеров AGTCAGTCCTTGGCCTCCTT (левого) и CAGTTTCGATCCTCCTCCAG (правого)  амплификацию следует проводить по следующей схеме: предварительная денатурация, 95 °С, 60 секунд, 1 цикл; денатурация, 95 °С, 30 секунд, 30 циклов; отжиг, 56 °С, 60 секунд, 30 циклов; элонгация, 72 °С, 30 секунд, 30 циклов,  дополнительная элонгация в течение 1 цикла продолжительностью 600 секунд.Установлена оптимальная концентрация компонентов реакционной смеси для проведения ПЦР. Подтверждена высокая специфичность разработанной тест-системы и олигонуклеотидных праймеров путем электрофоретического разделения образцов мясного фарша, содержащего патогенный прионный белок, а также путем  сравнительного анализа результатов определения патогенного прионного белка,полученных с помощью ПЦР-тест-системы и ИФА-системы «TeSeE™»

Screening and Characterization of the Antagonistic Properties of Microorganisms Isolated From Natural Sources

BACKGROUND: Human infectious diseases caused by antibiotic-resistant bacterial pathogens present a serious problem for clinical medicine. Causative agents of nosocomial infections, such as Escherichia coli, Klebsiella pneumoniae, Enterobacter spp., are the most common among them. An active search for antimicrobial agents that can effectively combat drugresistant pathogens is underway. Antimicrobial substances of bacterial origin are of particular interest. Promising sources of microorganisms with antibiotic properties are natural sources: Soil, water, plants, etc. AIM: The purpose of this work is to screen and characterize the antagonistic properties of microorganisms isolated from natural sources in connection with the creation of new pharmaceutical substances. METHODS: The material for the isolation of microorganisms was the soil, water bodies, and plant objects of various municipal districts of the Kemerovo Region. Identification of the isolated microorganisms was carried out using the methods proposed in the directory “Bergey’s Manual of Determinative Bacteriology” and in the monograph Nesterenko et al. The selection of strains from soil samples was carried out according to standard methods described in “Methods of soil microbiological control. Methodical recommendations,” cultural-morphological properties of isolates were studied using conventional microbiological methods. RESULTS: The following results are obtained: (1) Lactic acid bacteria and other microorganisms antagonists from natural sources were isolated: Soil, water bodies, and plant objects; 20 isolates were isolated, their cultural and morphological properties were studied; isolated microorganisms were found to belong presumably to the genera Bacillus, Leuconostoc, Pedio-coccus, Lactobacillus, and Bacteroides; (2) Antimicrobial properties of lactic acid bacteria and other antagonistic microorganisms isolated from natural sources on solid and liquid nutrient media were studied; (3) 12 strains of 20 isolates with maximum antimicrobial properties were selected for further studies. CONCLUSION: Further research on the biochemical properties of lactic acid bacteria and other antagonist microorganisms isolated from natural sources, the study of antibiotic resistance of lactic acid bacteria and other antagonist microorganisms isolated from natural sources, as well as other more detailed studies will be conducted with selected 12 strains with maximum antimicrobial properties

Nutritional features of indigenous people of Siberia and North America: Are we relatives?

People who inhabited North America came through the Bering Isthmus from Northeast Asia. They adapted to the new conditions of life and new food but perhaps preserved some of the traditions from their previous life. We studied the nutritional habits of the indigenous people of Siberia and North America. For a long time, hunting and gathering helped the aborigines to survive in the harsh conditions of the studied territories. Climate change after the glacial period allowed the Indians to provide themselves with products of plant origin, mastering agriculture. The harsh climate of Siberia practically did not change the traditions of the existence of indigenous people. Civilization equally adversely affected the people living in both the western and the eastern hemisphere. Nevertheless, there is more in common between us than differences. Keywords: Culture, Ethnic traditional food, Indigenous small-numbered peopl

Optimization of parameters for obtaining callus, suspension, and root cultures of meadowsweet (filipendula ulmaria) to isolate the largest number of biologically active substances with geroprotective properties

Abstract The study of biologically active substances-secondary metabolites of plants that exhibit geroprotective properties is an actual and popular direction in medicine to prevent early aging. This work aims to select the cultivation parameters for obtaining in vitro cell cultures of meadowsweet containing the largest amount of biologically active substances (BAS) for their further extraction as candidate substances for geroprotectors. To specify the effectiveness of the selected cell culture cultivation parameters, biomass growth for callus and root cultures, growth index, specific growth rate, and viability for suspension cultures was carried out. The study results made it possible to select the nutrient media for the cultivation of cell cultures of meadowsweet. It has been found that the greater the antioxidant activity of the extracts, the greater the antimicrobial properties it exhibits. In this study, cell cultures in vitro and alcohol extracts from the plant Filipendula ulmaria were considered as raw materials rich in candidate substances for geroprotectors. According to the data obtained, the plant is rich in hydroxybenzoic and salicylic acids, spireoside, avicularin, and hyperoside.</div

The Biological Active Substances of <i>Taraxacum officinale</i> and <i>Arctium lappa</i> from the Siberian Federal District

Currently, scientists are increasingly focusing on utilizing the natural flora of the planet to search for and isolate individual bioactive substances that prevent various diseases, contribute to increased life expectancy, and affect all major life-supporting systems in the human body. This study describes the examination of the composition of plant raw materials from the Siberian Federal District. The research focuses on plant specimens from the root parts of Taraxacum officinale and Arctium lappa, collected in the Kemerovo region. The study determines the contents of the water-soluble vitamins B and C in the research subjects. The investigation includes assessing antioxidant properties, antimicrobial activity, and flavonoid content in extracts based on plant raw materials. All samples show a high percentage of antioxidant activity, with the highest antioxidant activity for T. officinale at 85.51 and that for A. lappa at 88.97. The results indicate low antimicrobial activity against Escherichia coli (growth inhibition zone up to 15.5 mm). Plant extracts contain significant amounts of B-group vitamins, with pyridoxine in T. officinale (156.40 μg/mL) and thiamine (46.20 μg/mL) and pyridoxine (357.10 μg/mL) in Arctium lappa. Flavonoids (rutin and quercetin) are identified in T. officinale and A. lappa extracts based on the study results

Polymorphism of Genes Encoding DNA Repair Enzymes in Coal Mine Workers with Lung Cancer

В угольных шахтах на работников, выполняющих основные производственные операции под землей, воздействует целый комплекс канцерогенных факторов как химической, так и радиационной природы. Это приводит к значительному увеличению риска рака легкого у рабочих-подземщиков. Вероятность развития онкопатологии определяется генетически детерминированными особенностями защитных систем организма. В частности, активно исследуется роль унаследованных вариантов генов, кодирующих ферменты репарации ДНК. Однако их полиморфизм у шахтеров угольных шахт остается практически не изученным. Были изучены ассоциации полиморфизма генов ферментов репарации: hOGG1 (rs1052133), APEX1 (rs1130409), XPD (rs13181), NBS 1 (rs1805794) и ADPRT1 (rs1136410) с риском развития рака легкого у 213 шахтеров угольных шахт. В группу контроля вошло 247 здоровых работников угледобывающих предприятий Кемеровской области (Западная Сибирь, Кузбасс). Генотипирование проводили с помощью аллель- специфической ПЦР. Обнаружено, что изученные варианты генов были связаны с риском развития рака: полиморфизм гена APEX1 (доминантная модель: ORadj=1,71; CI 95 %: 1,04–2,81), XPD (доминантная модель: ORadj=2,12; CI 95 %: 1,30–3,46), ADPRT1 (рецессивная модель: ORadj=3,00; CI 95 %: 1,08–8,33). Результаты проведенной работы указывают на взаимосвязь между полиморфизмом генов ферментов репарации ДНК и риском рака легкого у работников угольных шахтIn coal mines, workers performing basic production operations underground are exposed to a whole range of both chemical and radiation-induced carcinogenic factors. This leads to a significant increase in the risk of lung cancer in underground mine workers. The likelihood of developing cancer is affected by genetically determined features of the body’s defense systems. Specifically, much research has been devoted to the role of inherited variants of genes encoding DNA repair enzymes. However, their polymorphism in coal miners remains largely unexplored. The present study investigated associations of the polymorphism of genes encoding DNA repair enzymes – hOGG1 (rs1052133), APEX1 (rs1130409), XPD (rs13181), NBS 1 (rs1805794), and ADPRT1 (rs1136410) – with the risk of developing lung cancer in coal miners. Two hundred and thirteen miners with lung cancer were examined. The control group included 247 healthy miners of the Kemerovo Region (Western Siberia, Kuzbass). Genotyping was performed using allele-specific PCR. The study showed that the following gene variants were associated with the risk of developing cancer: polymorphism of the genes APEX1 (dominant model: ORadj=1.71; CI 95 %: 1.04–2.81), XPD (dominant model: ORadj=2.12; CI 95 %: 1.30–3.46), and ADPRT1 (recessive model: ORadj=3.00; CI 95 %: 1.08–8.33). The results of this work suggest the relationship between the polymorphism of the genes of DNA repair enzymes and the risk of lung cancer in coal mine worker

Associations of polymorphisms in the cytokine genes IL1 beta (rs16944), IL6 (rs1800795), IL12b (rs3212227) and growth factor VEGFA (rs2010963) with anthracosilicosis in coal miners in Russia and related genotoxic effects

Anthracosilicosis (AS), a prevalent form of pneumoconiosis among coal miners, results from the accumulation of carbon and silica in the lungs from inhaled coal dust. This study investigated genotoxic effects and certain cytokine genes polymorphic variants in Russian coal miners with.S. Peripheral leukocytes were sampled from 129 patients with AS confirmed by X-ray and tissue biopsy and from 164 asymptomatic coal miners. Four single-nucleotide polymorphisms were genotyped in the extracted DNA samples: IL1 beta T-511C (rs16944), IL6 C-174G (rs1800795), IL12b A1188C (rs3212227) and VEGFA C634G (rs2010963). Genotoxic effects were assessed by the analysis of chromosome aberrations in cultured peripheral lymphocytes. The mean frequency of chromatid-type aberrations and chromosome-type aberrations, namely, chromatid-type breaks and dicentric chromosomes, was found to be higher in AS patients [3.70 (95% confidence interval {CI}, 3.29-4.10) and 0.28 (95% CI, 0.17-0.38)] compared to the control group [2.41 (95% CI, 2.00-2.82) and 0.09 (95% CI, 0.03-0.15)], respectively. IL1 beta gene T/T genotype (rs16944) was associated with AS [17.83% in AS patients against 4.35% in healthy donors, odds ratio = 4.77 (1.88-12.15), P < 0.01]. A significant increase in the level of certain chromosome interchanges among AS donors is of interest because such effects are typical for radiation damage and caused by acute oxidative stress. IL1 beta T allele probably may be considered as an AS susceptibility factor among coal miners.Russian Foundation for Basic ResearchKemerovo State Univ, Dept Genet, Soviet Ave 73, Kemerovo 650000, RussiaKemerovo State Univ, Dept Bionanotechnol, Blvd Stroiteley 47, Kemerovo 650056, RussiaKemerovo Reg Clin Hosp, Dept Occupat Pathol, Ave October 22, Kemerovo 650066, RussiaReg Clin Ctr Miners Hlth, Dept Occupat Pathol, 7th Microdist 9, Kemerovo Region 652509, RussiaRes Inst Complex Problems Hyg & Occupat Dis, St Kutuzova 23, Novokuznetsk 654041, RussiaRussian Acad Sci, Siberian Branch, Fed Res Ctr Coal & Coal Chem, Soviet Ave 18, Kemerovo 650000, RussiaNatl Environm Engn Res Inst, CSIR, Nagpur 440020, Maharashtra, IndiaLutheran Univ Brazil ULBRA, Postgrad Program Mol & Cellular Biol Appl Hlth, Lab Genet Toxicol, BR-92425900 Canoas, BrazilUniv Fed Sao Paulo, Inst Hlth & Soc, Dept Biosci, Rua Silva Jardim 136, BR-11015020 Sao Paulo, BrazilUniv Fed Sao Paulo, Inst Hlth & Soc, Dept Biosci, Rua Silva Jardim 136, BR-11015020 Sao Paulo, BrazilRFBR: 16-44-420926 r_aRFBR: 16-44-420087 r_aRFBR: 16-34-00441 mol_aWeb of Scienc

Associations of polymorphisms in the cytokine genes IL1β (rs16944), IL6 (rs1800795), IL12b (rs3212227) and growth factor VEGFA (rs2010963) with anthracosilicosis in coal miners in Russia and related genotoxic effects

Anthracosilicosis (AS), a prevalent form of pneumoconiosis among coal miners, results from the accumulation of carbon and silica in the lungs from inhaled coal dust. This study investigated genotoxic effects and certain cytokine genes polymorphic variants in Russian coal miners with АS. Peripheral leukocytes were sampled from 129 patients with AS confirmed by X-ray and tissue biopsy and from 164 asymptomatic coal miners. Four single-nucleotide polymorphisms were genotyped in the extracted DNA samples: IL1β T-511C (rs16944), IL6 C-174G (rs1800795), IL12b A1188C (rs3212227) and VEGFA C634G (rs2010963). Genotoxic effects were assessed by the analysis of chromosome aberrations in cultured peripheral lymphocytes. The mean frequency of chromatid-type aberrations and chromosome-type aberrations, namely, chromatid-type breaks and dicentric chromosomes, was found to be higher in AS patients [3.70 (95% confidence interval {CI}, 3.29–4.10) and 0.28 (95% CI, 0.17–0.38)] compared to the control group [2.41 (95% CI, 2.00–2.82)and 0.09 (95% CI, 0.03–0.15)], respectively. IL1β gene T/T genotype (rs16944) was associated with AS [17.83% in AS patients against 4.35% in healthy donors, odds ratio = 4.77 (1.88–12.15), P < 0.01]. A significant increase in the level of certain chromosome interchanges among AS donors is of interest because such effects are typical for radiation damage and caused by acute oxidative stress. IL1β T allele probably may be considered as an AS susceptibility factor among coal miners