The methodology of food design. Part 1. The individual aspect

Innovative technologies for food raw material processing and food production are becoming globally important within the framework of modern biotechnology. The need to create a universal methodology for food design and the importance of its implementation in different lines of human life activity are obvious. Within the paradigm of modern biotechnology, personalized diets that take into consideration the genetic characteristics of consumers are becoming more and more popular. Nutrition science deals with the development of this direction. It is divided into nutrigenetics and nutrigenomics. Nutrigenetics investigates an effect of modifications in genes on absorption of metabolites, nutrigenomics investigates how food components affect the work of genes. In this work, we consider mutations that influence the assimilation of metabolites and contribute to nutrigenetic research. The work is aimed at finding and studying genes responsible for eating behavior. Methods of analysis of genetic polymorphisms and modern achievements of nutrigenetics in the development of personalized nutrition are considered. The review allowed us to find and describe the genes that influenced human eating behavior: the role of genes, their localization, polymorphisms affecting the metabolism of nutrients and food preferences are indicated. Thirty four genes that influence eating behavior were identified, and significant shortcomings of current methods / programs for developing personalized diets were indicated. Weaknesses in the development of nutrigenetics were identified (inconsistency of data on SNP genes, ignoring population genetics data, information that is hard for consumers to understand, etc.). Taking into consideration all shortcomings, an approximate model for selecting a personalized diet is proposed. In the future, it is planned to develop the proposed model for making up individual diets

The methodology of food design. Part 2. Digital nutritiology in personal food

Atherosclerosis (the main cause of a wide range of cardiovascular diseases) and other multifactorial diseases depend on several nutrition factors, defined in general by lifestyle that directly and constantly affects the human body. The modern level of science and technology development is able to form a diet, taking into account all personal characteristics in such a way that makes nutrition an effective preventive measure against diseases in order to keep a person healthy. The purpose of this article is to define and study all the limitations (the scope of its coverage in the scientific literature) that arose in the process of research aimed to formation of an integrated personal approach to designing of nutrition to prevent atherosclerosis. The object of the study was scientific literature, which is available in open source and free access databases: PubMed, ScienceDirect, eLIBRARY.RU, www.fips.ru, Patentscope. The language of search is Russian and English, search depth is 12 years. In the course of the research two food design concepts were found that affect process of digitalization in the food sector: the concept “FoodTech” (food technology) and digital nutritiology. It was established that in Russia only one company — LLC “City Supermarket” (Moscow), that works with the brand “Azbuka Vkusa” — acts in the sphere of “FoodTech” on the Russian market. This company selects personalized food, taking into account the results of personal nutrigenetic tests, in cooperation with LLC “Genotech” (Moscow). There is a need to use biological information, statistical information processing (nutrigenetic studies, nutrigenomic research) and machine-aided data processing (machine learning) for further generation of automatic algorithm that compiles personal recommendations. The relevance of generation of a national domestic database on chemical composition of food products (presented in the market) to simplify the preparation of individual personal diets is observed. We underline the necessity to use the test-organisms, i. e. dorio fish / zebrafish (Danio rerio) and nematodes (Caenorhabditis elegans)), which were used to determine the activity of candidate substances — the biologically active substances that feature antiatherosclerotic properties. In the future the authors plan to conduct a nutrigenomic and nutrigenetic study, using digital achievements. To collect information about consumers, it is necessary to apply digital devices, and use biological informatics to process the results; after that it is necessary to generate the algorithm for automatic selection of personalized dietary recommendations

Tackling atherosclerosis via selected nutrition

The development and pathogenesis of atherosclerosis are significantly influenced by lifestyle, particularly nutrition. The modern level of science and technology development promote personalized nutrition as an efficient preventive measure against atherosclerosis. In this survey, the factors were revealed that contribute to the formation of an individual approach to nutrition: genetic characteristics, the state of the microbiota of the gastrointestinal tract (GIT) and environmental factors (diets, bioactive components, cardioprotectors, etc.). In the course of the work, it was found that in order to analyze the predisposition to atherosclerosis associated with nutrition, genetic features affecting the metabolism of nutrients are significant. The genetic features include the presence of single nucleotide polymorphisms (SNP) of genes and epigenetic factors. The influence of telomere length on the pathogenesis of atherosclerosis and circadian rhythms was also considered. Relatively new is the study of the relationship between chrono-nutrition and the development of metabolic diseases. That is, to obtain the relationship between nutrition and atherosclerosis, a large number of genetic markers should be considered. In this relation, the question arises: “How many genetic features need to be analyzed in order to form a personalized diet for the consumer?” Basically, companies engaged in nutrigenetic research and choosing a diet for the prevention of a number of metabolic diseases use SNP analysis of genes that accounts for lipid metabolism, vitamins, the body’s antioxidant defense system, taste characteristics, etc. There is no set number of genetic markers. The main diets effective against the development of atherosclerosis were considered, and the most popular were the ketogenic, Mediterranean, and DASH-diets. The advantage of these diets is the content of foods with a low amount of carbohydrates, a high amount of vegetables, fruits and berries, as well as foods rich in antioxidants. However, due to the restrictions associated with climatic, geographical, material features, these diets are not available for a number of consumers. The way out is the use of functional products, dietary supplements. In this approach, the promising biologically active substances (BAS) that exhibit anti-atherosclerotic potential are: baicalin, resveratrol, curcumin, quercetin and other plant metabolites. Among the substances, those of animal origin are popular: squalene, coenzyme Q10, omega-3. For the prevention of atherosclerosis through personalized nutrition, it is necessary to analyze the genetic characteristics (SNP) associated with the metabolism of nutrients, to assess the state of the microbiota of the GIT. Based on the data obtained and food preferences, as well as the individual capabilities of the consumer, the optimal diet can be selected. It is topical to exclude nutrients of which their excess consumption stimulates the occurrence and pathogenesis of atherosclerosis and to enrich the diet with functional foods (FF), BAS containing the necessary anti-atherosclerotic, and stimulating microbiota of the GIT nutrients. Personalized nutrition is a topical preventive measure and there are a number of problems hindering the active use of this approach among consumers. The key factors include weak evidence of the influence of a number of genetic features, the high cost of the approach, and difficulties in the interpretation of the results. Eliminating these deficiencies will contribute to the maintenance of a healthy state of the population through nutrition

Concept for the Southern Campus of the Network University of the Kuzbass Research and Education Center

Данная концептуальная статья посвящена разработке концепции кампуса «Новый город» сетевого университета Научно-образовательного центра мирового уровня «Кузбасс». Целью работы является оценка роли кампуса в проекте сетевого университета для повышения эффективности системы образования Кузбасса и управления его ресурсным состоянием. Объектом исследования выступают проектируемые инфраструктурные решения по кампусу «Новый город» сетевого вуза Кузбасса в образовательном контексте. В ходе исследования использованы методы формирования концептуальных предложений, функционального зонирования городского пространства, градостроительного анализа территории. Создание кампуса «Новый город» как открытой, комфортной и развивающей среды университетского, бизнес- и туристического кластера обеспечит выход сетевого университета НОЦ «Кузбасс» на уровень лучших мировых аналогов, создаст площадку для глобальной конкуренции в области образования, исследований и внедрения их результатов в производство, предоставит возможности для реализации современного интеллектуально насыщенного и оздоровительно-спортивного образа жизни и оптимизации использования территориальных ресурсов.The article introduces the concept of the New Town Campus as a part of the Network University of the World Class Research and Academic Center «Kuzbass». The research objective is to assess the role of the Campus within the Network University project aimed at improving the efficiency of the local education and managing its resources. The research features the infrastructure solutions for the future New Town Campus and involves the methods of conceptual proposals, functional zoning of urban environment, and urban planning. The New Town as an open, comfortable, and encouraging platform will ensure the world-class development of the business-tourism cluster, eventually turning the Network University into a platform able to compete with global leaders in education, research, and production. The Campus will also create opportunities for the modern intellectual and healthy lifestyle while optimizing the use of territorial resources.Автор выражает признательность автономной некоммерческой организации «Научно-образовательный центр “Кузбасс”» за разработку программы развития высшего образования в Кемеровской области.The author thanks the Kuzbass Research and Education Center for their Program for Advancing Higher Education in the Region

Russian Students’ Ideas About the Quality of Life: Transformation Under the COVID-19 Pandemic

The paper views change in Russian university students’ ideas about the quality of life during the pandemic. This empirical longitudinal study involved 107 first-year students of Kemerovo State University. To identify their ideas about the quality of life, R. S. Eliot’s Quality of Life Index was used in the Russian language adaptation by N. E. Vodopyanova. The students were surveyed at the beginning of the online learning mode (April 2020), after 8 months of online classes, and upon switching back from online learning (September 2021). The initial sampling demonstrated the students’ average extent of satisfaction with their quality of life during the lockdown. Among the problems they reported a poor ability to organize their own time, to act in difficult and changing circumstances, to control emotions. The students’ satisfaction with personal relations and studies, in general, remained high. In the autumn of 2020, a significant decrease in most indicators under study was found in the surveyed group. In September 2021, the students showed positive trends in the parameters in question

Antiradical and Oxidative Stress Release Properties of Trifolium pratense L. extract

Low adaptive capacity and oxidative stress are the factors leading to cellular dysfunction, protein and lipid peroxidation, and the development of diseases. In recent decades, there has been a trend toward the active use of plant-based antioxidants. Trifolium pratense L. is a promising plant for the pharmaceutical and food industry and has anti-radical properties. This work is devoted to studying the antiradical and oxidative stress-released properties of T. pratense in Caenorhabditis elegans under oxidative and temperature stress. The objective of this research was to evaluate the anti-radical properties of the T. pratense extracts and individual BAS (chlorogenic acid, ononin, biochanin A, genistein) and analysis their influences on the oxidative stress of Caenorhabditis elegans in the presence of paraquat. Analysis of the antiradical properties revealed that chlorogenic acid has the maximum ability to neutralize the free radical (35.49µmol). A separate analysis of oxidative stress revealed high ononin activity at concentrations of 10, 50, and 100 µmol at 48 hours of cultivation.  Biochanin A increases survival by 13.1% compared to the control. The use of the extract (500µmol) contributed to an increase in survival on day 1 of incubation. Under conditions of thermal stress, ononin (50 and 200 µmol) has a positive effect on the viability of C. elegans.  The extract and BAS of T. pratense are characterized by high antiradical activity. In addition, the ability to influence the viability of C. elegans was revealed. Therefore, it is worthwhile to further study the biological properties of T. pratense for use in geroprotective therapy

Microorganisms for bioremediation of soils contaminated with heavy metals

Heavy-metal contaminants are one of the most relevant problems of contemporary agriculture. High toxicity and the ability to accumulate in soils and crops pose a serious threat to food security. To solve this problem, it is necessary to accelerate the pace of restoration of disturbed agricultural lands. Bioremediation is an effective treatment for agricultural soil pollution. It relies on the ability of microorganisms to remove pollutants. The purpose of this study is to create a consortium based on microorganisms isolated from technogenic sites for further development in the field of soil restoration in agriculture. In the study, promising strains that can remove heavy metals from experimental media were selected: Pantoea sp., Achromobacter denitrificans, Klebsiella oxytoca, Rhizobium radiobacter, and Pseudomonas fluorescens. On their basis, consortiums were compiled, which were investigated for the ability to remove heavy metals from nutrient media, as well as to produce phytohormones. The most effective was Consortium D, which included Achromobacter denitrificans, Klebsiella oxytoca, and Rhizobium radiobacter in a ratio of 1:1:2, respectively. The ability of this consortium to produce indole-3-acetic acid and indole-3-butyric acid was 18.03 μg/L and 2.02 μg/L, respectively; the absorption capacity for heavy metals from the experimental media was Cd (56.39 mg/L), Hg (58.03 mg/L), As (61.17 mg/L), Pb (91.13 mg/L), and Ni (98.22 mg/L). Consortium D has also been found to be effective in conditions of mixed heavy-metal contamination. Due to the fact that the further use of the consortium will be focused on the soil of agricultural land cleanup, its ability to intensify the process of phytoremediation has been studied. The combined use of Trifolium pratense L. and the developed consortium ensured the removal of about 32% Pb, 15% As, 13% Hg, 31% Ni, and 25% Cd from the soil. Further research will be aimed at developing a biological product to improve the efficiency of remediation of lands withdrawn from agricultural use

Study of the effect of baicalin from Scutellaria baicalensis on the gastrointestinal tract normoflora and Helicobacter pylori

The antimicrobial properties of baicalin against H. pylori and several probiotic cultures were evaluated. Baicalin was isolated from a dry plant extract obtained by extraction with water at 70 ◦C. For isolation, extraction was carried out with n-butanol and purification on a chromatographic column. The antimicrobial potential was assessed by evaluating changes in the optical density of the bacterial suspension during cultivation; additionally, the disk diffusion method was used. During the study, the baicalin concentrations (0.25, 0.5, and 1 mg/mL) and the pH of the medium in the range of 1.5–8.0 were tested. The test objects were: suspensions of H. pylori, Lactobacillus casei, L. brevis, Bifidobacterium longum, and B. teenis. It was found that the greater the concentration of the substance in the solution, the greater the delay in the growth of the strain zone. Thus, the highest antimicrobial activity against H. pylori was observed at pH 1.5–2.0 and a baicalin concentration of 1.00 mg/mL. In relation to probiotic strains, a stimulating effect of baicalin (1.00 mg/mL) on the growth of L. casei biomass at pH 1.5–2.0 was observed. The results open up the prospects for the use of baicalin and probiotics for the treatment of diseases caused by H. pylori

Screening and Characterization of the Antagonistic Properties of Microorganisms Isolated From Natural Sources

BACKGROUND: Human infectious diseases caused by antibiotic-resistant bacterial pathogens present a serious problem for clinical medicine. Causative agents of nosocomial infections, such as Escherichia coli, Klebsiella pneumoniae, Enterobacter spp., are the most common among them. An active search for antimicrobial agents that can effectively combat drugresistant pathogens is underway. Antimicrobial substances of bacterial origin are of particular interest. Promising sources of microorganisms with antibiotic properties are natural sources: Soil, water, plants, etc. AIM: The purpose of this work is to screen and characterize the antagonistic properties of microorganisms isolated from natural sources in connection with the creation of new pharmaceutical substances. METHODS: The material for the isolation of microorganisms was the soil, water bodies, and plant objects of various municipal districts of the Kemerovo Region. Identification of the isolated microorganisms was carried out using the methods proposed in the directory “Bergey’s Manual of Determinative Bacteriology” and in the monograph Nesterenko et al. The selection of strains from soil samples was carried out according to standard methods described in “Methods of soil microbiological control. Methodical recommendations,” cultural-morphological properties of isolates were studied using conventional microbiological methods. RESULTS: The following results are obtained: (1) Lactic acid bacteria and other microorganisms antagonists from natural sources were isolated: Soil, water bodies, and plant objects; 20 isolates were isolated, their cultural and morphological properties were studied; isolated microorganisms were found to belong presumably to the genera Bacillus, Leuconostoc, Pedio-coccus, Lactobacillus, and Bacteroides; (2) Antimicrobial properties of lactic acid bacteria and other antagonistic microorganisms isolated from natural sources on solid and liquid nutrient media were studied; (3) 12 strains of 20 isolates with maximum antimicrobial properties were selected for further studies. CONCLUSION: Further research on the biochemical properties of lactic acid bacteria and other antagonist microorganisms isolated from natural sources, the study of antibiotic resistance of lactic acid bacteria and other antagonist microorganisms isolated from natural sources, as well as other more detailed studies will be conducted with selected 12 strains with maximum antimicrobial properties

ИССЛЕДОВАНИЕ И РАЗРАБОТКА МЕТОДА КОНТРОЛЯ ПАТОГЕННЫХ ПРИОННЫХ ИНФЕКЦИЙ ПОБОЧНОГО СЫРЬЯ МЯСНОЙ ПРОМЫШЛЕННОСТИ

Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries) revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail). The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left) and CAGTTTCGATCCTCCTCCAG (right) primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.Разработан высокочувствительный и специфичный метод идентификации патогенного прионного белка. Установлено, что фракции водорастворимых белков говядины и плазмы крови сельскохозяйственных животных являются нормальными прионными белками крупного рогатого скота. Выравнивание последовательностей гена  патогенного и нормального прионного белка Ovisaries, показало, что нуклеотидные последовательности PrPc и PrPsc являются идентичными. Выбрано мышиное моноклональное антитело 15В3. Построена синтетическая последовательность, дли-ной 194 п.н., полученная случайным образом (ДНК-хвост). Созданная последовательность и последовательности базы данных гомологов не имеют. К синтезированному ДНК-хвосту подобраны 2 праймера размерами 20 п.н. Полученныеэкспериментальные данные указывают на то, что при использовании праймеров AGTCAGTCCTTGGCCTCCTT (левого) и CAGTTTCGATCCTCCTCCAG (правого)  амплификацию следует проводить по следующей схеме: предварительная денатурация, 95 °С, 60 секунд, 1 цикл; денатурация, 95 °С, 30 секунд, 30 циклов; отжиг, 56 °С, 60 секунд, 30 циклов; элонгация, 72 °С, 30 секунд, 30 циклов,  дополнительная элонгация в течение 1 цикла продолжительностью 600 секунд.Установлена оптимальная концентрация компонентов реакционной смеси для проведения ПЦР. Подтверждена высокая специфичность разработанной тест-системы и олигонуклеотидных праймеров путем электрофоретического разделения образцов мясного фарша, содержащего патогенный прионный белок, а также путем  сравнительного анализа результатов определения патогенного прионного белка,полученных с помощью ПЦР-тест-системы и ИФА-системы «TeSeE™»