GENE EDITING IN PIGS

Genetically modified animals, especially rodents, are widely used in biomedical research. However, non-rodent models are required for efficient translational medicine and preclinical studies. Owing to the similarity in the physiological traits of pigs and humans, genetically modified pigs may be a valuable resource for biomedical research. Somatic cell nuclear transfer (SCNT) using genetically modified somatic cells has been the primary method for the generation of genetically modified pigs. However, site-specific gene modification in porcine cells is inefficient and requires laborious and time-consuming processes. Recent improvements in gene-editing systems, such as zinc finger nucleases, transcription activator-like effector nucleases, and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (CRISPR/Cas) system, represent major advances. The efficient introduction of site-specific modifications into cells via gene editors dramatically reduces the effort and time required to generate genetically modified pigs. Furthermore, gene editors enable direct gene modification during embryogenesis, bypassing the SCNT procedure. The application of gene editors has progressively expanded, and a range of strategies is now available for porcine gene engineering. This review provides an overview of approaches for the generation of genetically modified pigs using gene editors, and highlights the current trends, as well as the limitations, of gene editing in pigs

Efficacy of Abdominal Ultrasonography for Differentiation of Gastrointestinal Diseases in Calves

Gastrointestinal diseases represent one of the common causes of bovine acute abdomen, such as abdominal distention, abdominal pain, and cessation of defecation. In addition to the observable signs when performing routine auscultation, rectal palpation, and biochemical examinations of ruminal fluid and blood, these clinical observations can provide evidence suggestive of these diseases, but they generally result in an inconclusive diagnosis. Therefore, exploratory laparotomy is often used because it facilitates both diagnosis and therapeutic decisions. For bovines, abdominal ultrasonography is frequently utilized as a convenient imaging modality to assist accurate diagnosis and contribute to subsequent appropriate therapeutic choices for bovine gastrointestinal diseases. According to recent trends in human medicine and small animal practice, technical improvements have led to developments in the diagnostic value of abdominal ultrasonography, including scanning methods and the establishment of valuable diagnostic signs specific to a particular disease, e.g., a target sign for intussusception.This study investigated the clinical efficacy of abdominal ultrasonography for abomasal dilation in three calves, intestinal volvulus in five calves, intussusception in one calf, and internal hernia in one calf. In the abdominal ultrasonograms of the abomasal dilation cases, this disease was commonly characterized by severely extended lumens, including heterogeneously hyperechoic ingesta without intraluminal accumulations of gas. In the animals with intestinal volvulus and intussusception, a to-and-fro flow was observed to be a common ultrasonographic characteristic that led to suspicion of an intestinal obstruction. The use of abdominal ultrasonography for five cases with intestinal volvulus gave no reason to suspect this disease, despite its efficacy in one case, based on an acutely angled narrowing. Although three of five animals with intestinal volvulus had intestinal ruptures, no ultrasonographic evidence could be obtained. When abdominal ultrasonography was used for one case with intussusception, this pathological condition could be strongly suspected, as a “target” sign was observed. This finding supported surgical intervention for this case, followed by treatment with manual reduction, resulting in a favorable outcome. In terms of the differential and definitive diagnosis for various intestinal diseases, abdominal ultrasonography may be poor at providing indicative evidence, but very helpful for confirming intestinal obstruction

Dimethyl sulfoxide-free cryopreservation solution containing trehalose, dextran 40, and propylene glycol for therapy with human adipose tissue-derived mesenchymal stromal cells

We evaluated a dimethyl sulfoxide (Me2SO)-free cryopreservation solution to freeze human adipose-derived mesenchymal stromal cells (hADSCs). In the first experiment, we compared the combined effects of 3% trehalose (3 T) and 5% dextran (5D) in lactated Ringer’s solution (LR) as a cryopreservation base solution containing 10% propylene glycol (PG). The cell viability of hADSCs immediately after thawing was significantly higher (p < 0.05) in LR supplemented with 3 T (LR-3 T) and with 3 T and 5D (LR-3 T-5D) than in LR. In the second experiment, we compared the cell characteristics of hADSCs freeze-thawed in LR-3 T-5D containing either 10% Me2SO or 10% PG. The cell viability, annexin V-positive ratio, colony-forming capacity, cell proliferation, cell surface antigen positivity, adipogenic differentiation, osteogenic differentiation, and genetic response to cytokine stimulation of hADSCs immediately after thawing were similar between the LR-3 T-5D containing 10% Me2SO and 10% PG. In the third experiment, we examined various concentrations of PG on the cell proliferative capacity of freeze-thawed hADSCs. The cell proliferative capacity of hADSCs frozen with LR-3 T-5D containing 2.5% to 5% PG was significantly higher (p < 0.05) than LR-3 T-5D containing 10% PG. Furthermore, the cell proliferative capacity of hADSCs frozen with LR-3 T-5D containing 4% PG was similar to that of fresh hADSCs. These results indicate that the combination of 3 T-5D in an LR solution as a basic solution is effective for post-thaw cell viability, and that the optimal concentration of PG to maintain the cell characteristics of hADSCs frozen with LR-3 T-5D is 2.5% to 5%, which is promising for cell therapy applications

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

<p>Abstract</p> <p>Background</p> <p>Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine <it>PRNP</it> (b<it>PRNP</it>) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down b<it>PRNP</it> were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of <it>PRNP</it>, and lengths of siRNAs.</p> <p>Results</p> <p>Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNA^Valpromoter. Six target sites of bovine <it>PRNP </it>were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire b<it>PRNP </it>coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or <it>Renilla </it>luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a <it>Bsp </it>MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.</p> <p>Conclusion</p> <p>Four siRNA expression plasmid vectors, six target sites of b<it>PRNP</it>, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of b<it>PRNP </it>in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.</p

Canine follicular development treated by hormones

Ovarian follicular dynamics is not well known in dogs. Imaging of ovaries is technically difficult; however, ovaries clamped at a subcutaneous site can more easily be monitored using ultrasound imaging. This study investigated the follicular development of canine ovaries stimulated by hormone treatment using ultrasound imaging of the ovaries clamped at a subcutaneous site. Oestrus was induced using subcutaneous administration of 500 IU equine chorionic gonadotropin (eCG) and 1000 IU human chorionic gonadotropin (hCG) (eCG/hCG). Five bitches were given 1000 IU hCG 11 days after eCG/hCG administration. Examinations with ovarian ultrasonography using a 7.5‐MHz sector transducer, vaginal cytology, and assays of serum oestrogen and progesterone were performed daily until 20 days after eCG/hCG administration. Serosanguineous vaginal discharges and vaginal cytology of two of the bitches were observed. New follicular growth (>1.0 mm in diameter) was observed in all bitches from 2 to 8 days after eCG/hCG administration. The mean diameter of follicles and maximum numbers of follicles per ovary ranged from 2.8 to 5.5 mm and 4 to 16, respectively. The elevation in oestrogen concentrations after eCG/hCG administration was observed in all bitches, and elevation in progesterone concentration (>2 ng mL−1) was observed in three bitches. However, no follicles ovulated until 9 days after hCG administration. In conclusion, although the number of examined bitches were limited, follicular growth in ovaries clamped at a subcutaneous site can be monitored using ultrasound imaging. Ovarian ultrasonography showed that eCG/hCG administration induced new follicular growth and hCG administration induced increases in oestrogen concentrations but not ovulation by hCG administration

EFFECT OF FERULIC ACID ON PIG OOCYTES

The value of laboratory and genetically-modified pigs is becoming increasingly clear; however, their in vitro development remains inefficient. Trans-ferulic acid (trans-FA) is an aromatic compound that is abundant in plant cell walls, and which exhibits antioxidant effects in vitro. Trans-FA is known to improve sperm viability and motility; however, its effects on porcine oocytes are unknown. Our aim was to investigate the effects of trans-FA supplementation during in vitro maturation on the meiotic and developmental competence of porcine oocytes. Oocytes were matured either without (control) or with trans-FA (10, 100 and 1,000 µM), fertilized, and cultured in vitro for 7 days. The maturation rate of oocytes cultured with 10 µM trans-FA (81.6%) was significantly higher than that of controls (65.0%; P<0.05). The fertilization rate of oocytes matured with 10 µM trans-FA (57.4%) was also significantly higher than that of controls (32.7%) and oocytes cultured with other concentrations (33.1% and 22.7% for 100 and 1,000 µM, respectively; P<0.05). Moreover, the blastocyst formation rate of oocytes matured with 10 µM trans-FA (6.9%) was significantly higher than that of controls (2.3%; P<0.05). Our results suggest that in vitro maturation with 10 µM trans-FA is beneficial for the in vitro production of porcine embryos and has the potential to improve production system

One-Step Generation of Multiple Gene-Edited Pigs by Electroporation of the CRISPR/Cas9 System into Zygotes to Reduce Xenoantigen Biosynthesis

Xenoantigens cause hyperacute rejection and limit the success of interspecific xenografts. Therefore, genes involved in xenoantigen biosynthesis, such as GGTA1, CMAH, and B4GALNT2, are key targets to improve the outcomes of xenotransplantation. In this study, we introduced a CRISPR/Cas9 system simultaneously targeting GGTA1, CMAH, and B4GALNT2 into in vitro-fertilized zygotes using electroporation for the one-step generation of multiple gene-edited pigs without xenoantigens. First, we optimized the combination of guide RNAs (gRNAs) targeting GGTA1 and CMAH with respect to gene editing efficiency in zygotes, and transferred electroporated embryos with the optimized gRNAs and Cas9 into recipient gilts. Next, we optimized the Cas9 protein concentration with respect to the gene editing efficiency when GGTA1, CMAH, and B4GALNT2 were targeted simultaneously, and generated gene-edited pigs using the optimized conditions. We achieved the one-step generation of GGTA1/CMAH double-edited pigs and GGTA1/CMAH/B4GALNT2 triple-edited pigs. Immunohistological analyses demonstrated the downregulation of xenoantigens; however, these multiple gene-edited pigs were genetic mosaics that failed to knock out some xenoantigens. Although mosaicism should be resolved, the electroporation technique could become a primary method for the one-step generation of multiple gene modifications in pigs aimed at improving pig-to-human xenotransplantation

EMBRYONIC MOSAICISM BY MICROINJECTION

Cytoplasmic microinjection (CI) of the CRISPR/Cas9 system enabled the induction of site-specific mutations in porcine zygotes and resulting pigs. However, mosaicism is a serious problem for genetically modified pigs. In the present study, we investigated suitable timing and concentration of CRISPR/Cas9 components for introduction into oocytes/zygotes by CI, to reduce mosaicism in the resulting blastocysts. First, we introduced 20 ng/μl of Cas9 protein and guide RNA (gRNA), targeting the α-1,3-galactosyltransferase (GalT) gene in oocytes before in vitro fertilization (IVF), in zygotes after IVF, or in oocytes/zygotes before and after IVF, twice. CI treatment had no detrimental effects on blastocyst formation rates. The highest value of the rate of mutant blastocysts was observed in zygotes injected after IVF. Next, we injected Cas9 protein and gRNA into zygotes after IVF at a concentration of 20 ng/μl each (20 ng/μl group) or 100 ng/μl each (100 ng/μl group). The ratio of the number of blastocysts that carried mutations to the total number of blastocysts examined in the 100 ng/μl group was significantly higher (P < 0.05) than that in the 20 ng/μl group. Although no blastocysts from the 20 ng/μl group carried a biallelic mutation, 16.7% of blastocysts from the 100 ng/μl group carried a biallelic mutation. In conclusion, increasing the concentration of Cas9 protein and gRNA is effective in generating biallelic mutant blastocysts. To reduce mosaicism, however, further optimization of the timing of CI, and the concentration of CRISPR/Cas9 components, is needed

Efficient generation of GGTA1-deficient pigs by electroporation of the CRISPR/Cas9 system into in vitro-fertilized zygotes

Background: Xenoantigens are a major source of concern with regard to the success of interspecific xenografts. GGTA1 encodes α1,3-galactosyltransferase, which is essential for the biosynthesis of galactosyl-alpha 1,3-galactose, the major xenoantigen causing hyperacute rejection. GGTA1-modified pigs, therefore, are promising donors for pig-to-human xenotransplantation. In this study, we developed a method for the introduction of the CRISPR/Cas9 system into in vitro-fertilized porcine zygotes via electroporation to generate GGTA1-modified pigs. Results: We designed five guide RNAs (gRNAs) targeting distinct sites in GGTA1. After the introduction of the Cas9 protein with each gRNA via electroporation, the gene editing efficiency in blastocysts developed from zygotes was evaluated. The gRNA with the highest gene editing efficiency was used to generate GGTA1-edited pigs. Six piglets were delivered from two recipient gilts after the transfer of electroporated zygotes with the Cas9/gRNA complex. Deep sequencing analysis revealed that five out of six piglets carried a biallelic mutation in the targeted region of GGTA1, with no off-target events. Furthermore, staining with isolectin B4 confirmed deficient GGTA1 function in GGTA1 biallelic mutant piglets. Conclusions: We established GGTA1-modified pigs with high efficiency by introducing a CRISPR/Cas9 system into zygotes via electroporation. Multiple gene modifications, including knock-ins of human genes, in porcine zygotes via electroporation may further improve the application of the technique in pig-to-human xenotransplantation

Effects of skim-milk supplementation on the quality and penetrating ability of boar semen after long-term preservation at 15 °C

This study investigated the effects of skim-milk supplementation on the quality and penetrating ability of boar semen preserved at 15 °C. When boar semen samples were preserved in Modified Modena extender supplemented with various concentrations (0, 7.5, 15, 30 and 50 mg/mL) of skim milk powder at 15 °C for 4 weeks, higher sperm motility and viability were observed in the case of 7.5 mg/mL skim-milk supplementation compared with the control group (0 mg/mL) during the preservation (P < 0.05). When in vitro matured oocytes were co-incubated with boar sperm that had been preserved in Modified Modena extender with three different concentrations (0, 7.5 or 15 mg/mL) of skim milk powder at 15 °C for two weeks, there were no apparent effects of skim-milk supplementation on the rates of fertilisation and development to blastocysts of oocytes after co-incubation. However, the monospermic fertilisation rate of sperm preserved with 15 mg/mL skim milk powder was higher (P < 0.05) than that of fresh non-preserved sperm, but did not differ among the preservation groups. The results indicate that the supplementation of Modified Modena extender with 7.5 mg/mL skim milk powder improves the motility and viability, but not the penetrating ability, of sperm after liquid preservation for at least two weeks