GGE biplot analysis of yield stability for Andean dry bean accessions grown under different abiotic stress regimes in Tanzania

Large seeded Andean dry beans ( Phaseolus vulgaris L.) are most preferred in Africa. However, low soil fertility and increasing drought stress conditions due to climate change are among the challenges faced by farmers in this region. The purpose of this study was to identify Andean genotypes with yield stability and to identify the best environments for selection of this trait. GGE-Biplot analysis was used to examine 183 Andean bean genotypes in Tanzania. Results indicated significant environment (E), genotype (G) and genotype x environment (GE) effects for seed yield. The environment explained 46%, genotype 20%, and GE 34% of the total (G + E + GE) variation. Two principal components explained 41.21% (PC1) and 26.35% (PC2) of GGE sum of squares. The Andean genotypes, ADP-102 (Jessica)- purple mottle, large seed, bush plant habit,\ua0released by Selian Agriculture Research Institution (ARI) in Tanzania; ADP-220 (G5625)- red, large seed, vine plant habit, from Central America; ADP-276 (G13654) - brown, medium seed, vine, from Mexico; and ADP-648 (\u2018Red Kloud\u2019) large red kidney, with bush plant habit, were stable across environments and can be recommended for general adaptation across environments. An individual location for selection for yield stability was not identified, thus justifying the continued need for multiple test sites.Les haricots secs andins \ue0 grosses graines ( Phaseolus vulgaris L.) sont les plus pr\ue9f\ue9r\ue9s en Afrique. Cependant, la faible fertilit\ue9 du sol et le stress croissant de la s\ue9cheresse caus\ue9 par le changement climatique font partie des d\ue9fis auxquels sont confront\ue9s les agriculteurs de cette r\ue9gion. L\u2018objectif de cette \ue9tude \ue9tait d\u2019identifier les g\ue9notypes andins avec une stabilit\ue9 de rendement et d\u2019identifier les meilleurs environnements pour la s\ue9lection de ce trait. L\u2019analyse GGE-Biplot a \ue9t\ue9 utilis\ue9e pour examiner 183 g\ue9notypes de haricot andin en Tanzanie. Les r\ue9sultats ont montr\ue9 des effets significatifs sur l\u2019environnement (E), le g\ue9notype (G) et le g\ue9notype x environnement (GE) sur le rendement en grain. L\u2019environnement expliquait 46%, le g\ue9notype 20% et l\u2019EG 34% de la variation totale (G + E + GE). Deux composantes principales expliquent 41,21% (PC1) et 26,35% (PC2) de la somme des carr\ue9s GGE. Les g\ue9notypes andins, ADP-102 (Jessica) - marron violet, grosse graine, habitude de plante de brousse, publi\ue9s par l\u2019Institut de recherche sur l\u2019agriculture Selian (ARI) en Tanzanie; ADP-220 (G5625) - Rouge, grosse graine, habitude de plante de la vigne, d\u2019Am\ue9rique centrale; ADP-276 (G13654) - brun, graine moyenne, vigne, en provenance du Mexique; et le grand rein rouge ADP-648 (\uabRed Kloud\ubb), avec l\u2018 habitude des plantes de brousse, \ue9taient stables dans tous les environnements et pouvaient \ueatre recommand\ue9s pour une adaptation g\ue9n\ue9rale dans tous les environnements. Un emplacement individuel pour la s\ue9lection de la stabilit\ue9 du rendement n\u2019a pas \ue9t\ue9 identifi\ue9, ce qui justifie le besoin de la continuite de test multiples des sites

First Report of Rice yellow mottle virus on Rice in Burundi

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the countr