Construction of pLLO vector encoding truncated form of Listeriolysin O as molecular adjuvant for DNA vaccine studies

Background: The major problem of DNA vaccine is less immunogenicity of them verses other killed or live whole organism vaccines therefore adjuvants for use in this kind vaccines is very necessary. Genetic adjuvants with bacterial sources are an appropriate approach to modulate immune responses to DNA vaccines. Listeria Monocytogenes proteins such as Listeriolysin O (LLO) with CD4 and CD8 epitopes can be as an adjuvant to initiate both innate and adaptive immune responses if the protein cytotoxicity can be eliminated. Herein we constructed a truncated LLO plasmid as genetic adjuvant and tested it in combination with a DNA construct as a model vaccine.Materials and Methods: About 1340bp of the 5' end of whole LLO gene was amplified by PCR on DNA purified from Listeria Monocytogenes. Sequential sub cloning of truncated LLO into the Xho I/EcoRV sites of pcDNA3.1 plasmid, downstream of CMV promoter was done. pLLO plasmid was transfected to HEK293T cell line by lipofection method. LLO protein expression from transiently transfected 293T cell lysates was confirmed by western blotting. Then the adjuvant activity of LLO in BALB/c mice model was analyzed using proliferation test.Results: Double digestion of pLLO plasmid with the enzymes that were applied for cloning led to the isolation of two fragments with expected sizes. The final plasmid was also confirmed following sequencing reactions. Moreover, expression of LLO was evidenced in transfected 293T cells, compared to non-transfected controls. In vivo study was shown, high significant proliferative responses in LLO co-immunization pattern.Conclusion: In the DNA vaccine study, LLO co-administration plasmid could be a suitable genetic adjuvant to enhance cellular immune response of vaccine

Epidemiology of West Nile Virus in the Eastern Mediterranean region: A systematic review.

BACKGROUND: West Nile Virus (WNV), a member of the genus Flavivirus, is one of the most widely distributed arboviruses in the world. Despite some evidence for circulation of WNV in countries summarized by the World Health Organization as the Eastern Mediterrian Regional Office (EMRO), comprehensive knowledge about its epidemiology remains largely unknown. This study aims to provide a concise review of the published literature on WNV infections in the Eastern Mediterranean Regional Office of WHO (EMRO). METHODOLOGY/PRINCIPAL FINDINGS: A systematic review of WNV prevalence studies on humans, animals and vectors in the EMRO region was performed by searching: Web of Science, Science Direct, Scopus, PubMed, Embase and Google Scholar. Finally, 77 citations were included, comprising 35 seroprevalence studies on general population (24460 individuals), 15 prevalence studies among patients (3439 individuals), 22 seroprevalence studies among animals (10309 animals), and 9 studies on vectors (184242 vector species). Of the 22 countries in this region, five had no data on WNV infection among different populations. These countries include Kuwait, Bahrain, Oman, Syria and Somalia. On the other hand, among countries with available data, WNV-specific antibodies were detected in the general population of all investigated countries including Djibouti (0.3-60%), Egypt (1-61%), Iran (0-30%), Iraq (11.6-15.1%), Jordan (8%), Lebanon (0.5-1%), Libya (2.3%), Morocco (0-18.8%), Pakistan (0.6-65.0%), Sudan (2.2-47%), and Tunisia (4.3-31.1%). WNV RNA were also detected in patient populations of Iran (1.2%), Pakistan (33.3%), and Tunisia (5.3% -15.9%). WNV-specific antibodies were also detected in a wide range of animal species. The highest seropositivity rate was observed among equids (100% in Morocco) and dogs (96% in Morocco). The highest seroprevalence among birds was seen in Tunisia (23%). In addition, WNV infection was detected in mosquitoes (Culex, and Aedes) and ticks (Argas reflexus hermanni). The primary vector of WNV (Culex pipiens s.l.) was detected in Djibouti, Egypt, Iran and Tunisia, and in mosquitoes of all these countries, WNV was demonstrated. CONCLUSIONS: This first systematic regional assessment of WNV prevalence provides evidence to support the circulation of WNV in the EMRO region as nearly all studies showed evidence of WNV infection in human as well as animal/vector populations. These findings highlight the need for continued prevention and control strategies and the collection of epidemiologic data for WNV epidemic status, especially in countries that lack reliable surveillance systems

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

Abstract Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection

Design, cloning and expression assay of oipA gene in a bicistronic vector harboring mice IL-18 gene: potential implications for Helicobacter pylori vaccine investigations

Introduction: Helicobacter pylori (H. pylori) infection has remained as a global health problem. Animal studies demonstrated the role of H. pylori oipA gene in the development of gastric cancer. The aim of this study was the cloning and expression of Helicobacter pylori oipA gene in a bicistronic vector harboring mice IL-18 gene. Materials and methods: The target gene encoding oipA was amplified from a codon-optimized clone by PCR, and then double-digested by restriction enzymes. The pIRES-Igk/mIL18/Fc plasmid was simultaneously digested by BstXI/NotI enzymes to elicit the eGFP segment. PCR product of oipA was inserted into pIRES-Igk/mIL18/Fc plasmid using T4 ligase. Transformation into DH5α strain was done. Cloning was confirmed by PCR, enzymatic digestion and sequencing. Expression of the oipA and IL-18 mRNA was assessed by means of TaqMan Real-time PCR. Results: Electrophoresis of PCR product, enzymatic digestion and sequencing showed that the H. pylori oipA gene was successfully cloned into pIRES-Igk/mIL18/Fc to generate mIL-18-pIRES2-oipA plasmid. The results of Real-time PCR confirmed the successful expression of both oipA and IL-18 in mouse macrophage cell line. Conclusion: Considering the role of oipA in pathogenesis of H. pylori and potent activity of IL-18 as a molecular adjuvant, the results of the present study showed that the expression of codon-optimized oipA gene in bicistronic vector including mouse IL-18 is successful. So, it could be considered as an appropriate genetic vaccine candidate for H. pylori in future investigations

Evaluation of Bax Encoding Plasmid For Increasing Efficacy of DNA Vaccine Plasmid Encoding gB of Herpes Simplex Virus Type 1

Objective: Evaluation of Bax encoding plasmid for increasing efficacy of DNAvaccine plasmid encoding gB of Herpes Simplex Virus type 1.Materials and Methods: We compared three different dosages of Bax encodingplasmid (pcbax) including 10, 25 and 50 μg of plasmid DNA. They were co-injectedineradermally with glycoprotein B (gB) of herpes simplex virus (HSV)-1 encodedplasmid (pcgB) in C57BL/6 mice to elicit immune responses to protect against lethalHSV-1 challenge. Immune responses to the antigen were assessed by lymphocyteproliferative responses and cytokine (INF-γ and IL-4) release assays.Results: The study demonstrates that the mice immunized with 25 μg pcbaxtogether with pcgB have more efficient protection than the mice immunized with 10and 50 μg of pcbax and pcgB. Analysing of cell-mediated responses show that themice immunized with 25μg pcbax and pcgB induce stronger lymphocyte proliferativeresponses and higher levels of INF-γ and IL-4 compared to the mice are received 10and 50 μg of pcbax and pcgB.Conclusion: The data show that co-immunization with 25 μg of pcbax and pcgBincrease immune responses compared to 10 and 50 μg of pcbax and pcgB. Thiscan be considered a promising approach for development an efficient DNA vaccineagainst HSV-1 or other pathogens

Antiviral Therapeutic Potential of Curcumin: An Update

The treatment of viral disease has become a medical challenge because of the increasing incidence and prevalence of human viral pathogens, as well as the lack of viable treatment alternatives, including plant-derived strategies. This review attempts to investigate the trends of research on in vitro antiviral effects of curcumin against different classes of human viral pathogens worldwide. Various electronic databases, including PubMed, Scopus, Web of Science, and Google Scholar were searched for published English articles evaluating the anti-viral activity of curcumin. Data were then extracted and analyzed. The forty-three studies (published from 1993 to 2020) that were identified contain data for 24 different viruses. The 50% cytotoxic concentration (CC50), 50% effective/inhibitory concentration (EC50/IC50), and stimulation index (SI) parameters showed that curcumin had antiviral activity against viruses causing diseases in humans. Data presented in this review highlight the potential antiviral applications of curcumin and open new avenues for further experiments on the clinical applications of curcumin and its derivatives

Antiviral Therapeutic Potential of Curcumin: An Update

The treatment of viral disease has become a medical challenge because of the increasing incidence and prevalence of human viral pathogens, as well as the lack of viable treatment alternatives, including plant-derived strategies. This review attempts to investigate the trends of research on in vitro antiviral effects of curcumin against different classes of human viral pathogens worldwide. Various electronic databases, including PubMed, Scopus, Web of Science, and Google Scholar were searched for published English articles evaluating the anti-viral activity of curcumin. Data were then extracted and analyzed. The forty-three studies (published from 1993 to 2020) that were identified contain data for 24 different viruses. The 50% cytotoxic concentration (CC50), 50% effective/inhibitory concentration (EC50/IC50), and stimulation index (SI) parameters showed that curcumin had antiviral activity against viruses causing diseases in humans. Data presented in this review highlight the potential antiviral applications of curcumin and open new avenues for further experiments on the clinical applications of curcumin and its derivatives