Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

<p>Abstract</p> <p>Background</p> <p>Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine <it>PRNP</it> (b<it>PRNP</it>) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down b<it>PRNP</it> were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of <it>PRNP</it>, and lengths of siRNAs.</p> <p>Results</p> <p>Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNA^Valpromoter. Six target sites of bovine <it>PRNP </it>were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire b<it>PRNP </it>coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or <it>Renilla </it>luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a <it>Bsp </it>MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.</p> <p>Conclusion</p> <p>Four siRNA expression plasmid vectors, six target sites of b<it>PRNP</it>, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of b<it>PRNP </it>in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.</p

Myosin motor Myo1c and its receptor NEMO/IKK-γ promote TNF-α–induced serine307 phosphorylation of IRS-1

Tumor necrosis factor-α (TNF-α) signaling through the IκB kinase (IKK) complex attenuates insulin action via the phosphorylation of insulin receptor substrate 1 (IRS-1) at Ser307. However, the precise molecular mechanism by which the IKK complex phosphorylates IRS-1 is unknown. In this study, we report nuclear factor κB essential modulator (NEMO)/IKK-γ subunit accumulation in membrane ruffles followed by an interaction with IRS-1. This intracellular trafficking of NEMO requires insulin, an intact actin cytoskeletal network, and the motor protein Myo1c. Increased Myo1c expression enhanced the NEMO–IRS-1 interaction, which is essential for TNF-α– induced phosphorylation of Ser307–IRS-1. In contrast, dominant inhibitory Myo1c cargo domain expression diminished this interaction and inhibited IRS-1 phosphorylation. NEMO expression also enhanced TNF-α–induced Ser307–IRS-1 phosphorylation and inhibited glucose uptake. In contrast, a deletion mutant of NEMO lacking the IKK-β–binding domain or silencing NEMO blocked the TNF-α signal. Thus, motor protein Myo1c and its receptor protein NEMO act cooperatively to form the IKK–IRS-1 complex and function in TNF-α–induced insulin resistance

Aggregation behavior of fluorooctanols in hydrocarbon solvents

金沢大学理工研究域物質化学系The association behaviors of three 1-octanols (1-octanol: C8OH; 1,1,2,2-tetrahydrotridecafluorooctanol TFC8OH; and 1,1-dihydropentadecafluorooctanol: DFC8OH) in two hydrocarbon solvents (n-hexane and benzene) were examined by vibration spectroscopy from 288.15 to 318.15 K. From the analysis of results with a mass action model, it was found that dimers and tetramers of 1-octanols coexisted with monomers in the n-hexane solution. These aggregates were formed by hydrogen bonding between the OH groups of 1-octanols. In the n-hexane solutions, an increase in the fluorination number of the 1-octanol molecule enhanced the intermolecular hydrogen bonding between the OH groups, but reduced the amounts of polymeric species. Conversely, in the benzene solution, the NIR experiment suggested that the OH groups of 1-octanols did not interact with other OH groups, but with the benzene molecules instead. It was found from 19F NMR chemical shift measurements that the fluorooctanols in the benzene solution aggregated by interaction between the fluorocarbon chains instead of by hydrogen bonding

Effect of asymmetric terminal structures of short RNA duplexes on the RNA interference activity and strand selection

Short interfering RNAs (siRNAs) are valuable reagents for sequence-specific inhibition of gene expression via the RNA interference (RNAi) pathway. Although it has been proposed that the relative thermodynamic stability at the 5′-ends of siRNAs plays a crucial role in siRNA strand selection, we demonstrate here that a character of the 2-nt 3′-overhang of siRNAs is the predominant determinant of which strand participates in the RNAi pathway. We show that siRNAs with a unilateral 2-nt 3′-overhang on the antisense strand are more effective than siRNAs with 3′-overhangs at both ends, due to preferential loading of the antisense strand into the RNA-induced silencing complex (RISC). Regardless of the relative thermodynamic stabilities at the ends of siRNAs, overhang-containing strands are predominantly selected as the guide strand; whereas, relative stability markedly influences opposite strand selection. Moreover, we show that sense strand modifications, such as deletions or DNA substitutions, of siRNAs with unilateral overhang on the antisense strand have no negative effect on the antisense strand selection, but may improve RNAi potency. Our findings provide useful guidelines for the design of potent siRNAs and contribute to understanding the crucial factors in determining strand selection in mammalian cells

Defective repair of radiation-induced DNA damage is complemented by a CHORI-230-65K18 BAC clone on rat chromosome 4

AbstractThe Long Evans cinnamon (LEC) rat is highly susceptible to X-irradiation due to defective DNA repair and is thus a model for hepatocellular carcinogenesis. We constructed a bacterial artificial chromosome (BAC) contig of rat chromosome 4 completely covering the region associated with radiation susceptibility. We used transient and stable transfections to demonstrate that defective DNA repair in LEC cells is fully complemented by a 200-kb BAC, CHORI-230-65K18. Further analysis showed that the region associated with radiation susceptibility is located in a 128,543-bp region of 65K18 that includes the known gene Rpn1. However, neither knockdown nor overexpression of Rpn1 indicated that this gene is associated with radiation susceptibility. We also mapped three ESTs (TC523872, TC533727, and CB607546) in the 128,543-bp region, suggesting that 65K18 contains an unknown gene associated with X-ray susceptibility in the LEC rat

An Excellent Monitoring System for Surface Ubiquitination-Induced Internalization in Mammals

Background. At present, it is difficult to visualize the internalization of surface receptors induced by ubiquitination that is taken place at the plasma membrane in mammals. This problem makes it difficult to reveal molecular basis for ubiquitinationmediated internalization in mammals. Methodology/Principle Findings. In order to overcome it, we have generated T-REx-c-MIR, a novel mammalian Tet-on B cell line using a constitutively active E3 ubiquitin ligase, c-MIR, and its artificial target molecule. By applying the surface biotinylation method to T-REx-c-MIR, we succeeded to monitor the fate of surface target molecules after initiation of ubiquitination process by doxycycline (Dox)-induced c-MIR expression. Target molecules that preexisted at the plasma membrane before induction of c-MIR expression were oligo-ubiquitinated and degraded by Dox-induced c-MIR expression. Dox-induced c-MIR expression initiated rapid internalization of surface target molecules, and blockage of the internalization induced the accumulation of the surface target molecules that were newly ubiquitinated by c-MIR. Inhibition of the surface ubiquitination by down-regulating ubiquitin conjugating enzyme E2 impaired the internalization of target molecules. Finally, a complex of c-MIR and target molecule was detected at the plasma membrane. Conclusions/ Significances. These results demonstrate that in T-REx-c-MIR, surface target molecule is ubiquitinated at the plasma membrane and followed by being internalized from the plasma membrane. Thus, T-REx-c-MIR is a useful experimental tool t

Histone Demethylase JMJD2B Functions as a Co-Factor of Estrogen Receptor in Breast Cancer Proliferation and Mammary Gland Development

Estrogen is a key regulator of normal function of female reproductive system and plays a pivotal role in the development and progression of breast cancer. Here, we demonstrate that JMJD2B (also known as KDM4B) constitutes a key component of the estrogen signaling pathway. JMJD2B is expressed in a high proportion of human breast tumors, and that expression levels significantly correlate with estrogen receptor (ER) positivity. In addition, 17-beta-estradiol (E2) induces JMJD2B expression in an ERα dependent manner. JMJD2B interacts with ERα and components of the SWI/SNF-B chromatin remodeling complex. JMJD2B is recruited to ERα target sites, demethylates H3K9me3 and facilitates transcription of ER responsive genes including MYB, MYC and CCND1. As a consequence, knockdown of JMJD2B severely impairs estrogen-induced cell proliferation and the tumor formation capacity of breast cancer cells. Furthermore, Jmjd2b-deletion in mammary epithelial cells exhibits delayed mammary gland development in female mice. Taken together, these findings suggest an essential role for JMJD2B in the estrogen signaling, and identify JMJD2B as a potential therapeutic target in breast cancer

Effects on RNAi of the tight structure, sequence and position of the targeted region

RNA interference (RNAi) is a gene-silencing phenomenon that involves the double-stranded RNA-mediated cleavage of mRNA, and small interfering RNAs (siRNAs) can cause RNAi in mammalian cells. There have been many attempts to clarify the mechanism of RNAi, but information about the relationship between the sequence and structure, in particular, a tight structure, of the target RNA and the activities of siRNAs are limited. In the present study, we examined this relationship by introducing the TAR element, which adopts a very stable secondary structure, at different positions within target RNAs. Our results suggested that the activities of siRNAs were affected by the tight stem–loop structure of TAR. In contrast, the position of the target within the mRNA, the binding of the Tat protein to the TAR, and the location of the target within a translated or a noncoding region had only marginal effects on RNAi. When the target sequence was placed in two different orientations, only one orientation had a significant effect on the activities of siRNA, demonstrating that the presence of certain nucleotides at some specific positions was favorable for RNAi. Systematic analysis of 47 different sites within 47 plasmids under identical conditions indicated that it is the target sequence itself, rather than its location, that is the major determinant of siRNA activity

Control of siRNA expression using the Cre–loxP recombination system

Gene silencing mediated by RNA interference (RNAi) was first discovered in Caenorhabditis elegans, and was subsequently recognized in various other organisms. In mammalian cells, RNAi can be induced by small interfering RNAs (siRNAs). In earlier studies, our group developed a vector-based system for expression of siRNA under control of a polymerase III promoter, the U6 promoter, which can induce RNAi in living cells. We here describe a system for controlling the U6 promoter-driven expression of siRNA using the Cre–loxP recombination system. We constructed a ‘Cre-On’ siRNA expression vector which could be switched on upon excision catalyzed by Cre recombinase, which was delivered to cells directly from the medium as a fusion protein. An examination of the effectiveness of RNAi against a reporter gene revealed that addition of TAT-NLS-Cre (where NLS is a nuclear localization signal and TAT is a peptide of 11 amino acids derived from HIV) to the medium resulted in plasmid recombination, generation of siRNA and suppression of reporter activity. This system should allow us to induce RNAi in a spatially, temporally, cell type-specifically or tissue-specifically controlled manner and potentiate the improved application of RNAi in both an experimental and a therapeutic context