Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S- ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E9, B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E9, B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.24525

Dispositivo Para O Controle De Baratas

O presente modelo de utilidade se refere a um dispositivo para o controle microbiano de baratas. O dispositivo, segundo o presente modelo de utilidade, é composto por uma caixa redonda (1) contituída de base (2) e tampa (3); dita base (2) sendo provida de aberturas (4) laterais inferiores e, na direção dessas, de cerdas intemas (5), sendo ainda que dita base (2) possui, centralmente, um pequeno receptáculo (6); dita tampa (3), por seu turno, é dotada internamente de um conjunto de cerdas (7) distribuídas próximo à sua periferia, de modo coincidente e de comprimento tal que atinja as ditas aberturas (4) da base (2).BR7200844 (U)A01H1/00A01H1/00BR7200844UA01H1/00A01H1/0

Not avaliable

No presente estudo procurou-se caracterizar-se o ciclo parassexual do fungo Metarhizium anisopliaea var. minor, isolado de insetos adultos de Deois sp. (Hom. Cerc.). Utilizando-se como mutagênico a luz ultra-violeta obteve-se mutantes morfológicos e auxotróficos para a biossíntese de aminoácidos e vitaminas. Estes mutantes foram utilizados para a formação de heterocários balanceados que se constituíram no ponto de partida para a produção de diplóides. Diplóides assim obtidos foram haploidizados através de 1,4-dicloro-2,5-dimetoxibenzeno (Cloroneb) adicionado ao meio seletivo; obteve-se assim a formação de setores haplóides que após análise demonstraram segregarem marcas tipos parentais e recombinantes, para requisitos nutricionais e morfologia. Técnicas citológicas permitiram a observação do fenômeno de fusão entre conídios e fusão de hifas de diferentes segmentos na linhagem haplóide. Pelas técnicas foi estudada também a variação no tamanho dos conídios e núcleos em linhagens haplóides e diplóides. Pelo tamanho do conídio não foi possível distinção entre linhagens haplóides e diplóides. No entanto. núcleos de conídios diplóides são maiores do que os de conídios haplóides.This research was accomplished in order to characterize the parasexual cycle in the fungus Metarhizium anisopliae var. minor isolated from adult insects of Deois sp. (Hom. Cerc.). Auxotrophic mutants for aminoacid and vitamin biosynthesis, as well as morphological mutants, were obtained by using ultraviolet light. These mutants were utilized in the formation of balanced heterokaryons, which in term served as a basis for the obtention of diploids. Diploids were then hybridized through the addition of 1.4 Dichloro-2.5-Dimetoxilbenzene (Chloroneb) to the selective medium. The analysis of haploid sectors thus obtained, indicated the segregation of parental and recombinant markers. both for morphological characters and for nutritional requirements. The use of cytological techniques allowed to observe, the fusion of conidia and the fusion of hypha in the haploid strain, as well as to measure conidia and nuclei size variation in haploid and diploid strains. The two kinds of strain could not be separated by measuring conidia size. Diploid conidia nuclei were, however, larger than those in the haploid strains

Parassexualidade e produção de aflatoxina em Aspergillus flavus, Link.

O presente trabalho foi realizado com a finalidade de se estudar aspectos relacionados com o ciclo parassexual e com a produção de aflatoxina em Aspergillus flavus. Para isso, foram usadas três linhagens de A. flavus, isoladas de amendoim (A5a, A6e e B2d), e foram obtidos mutantes auxotróficos e morfológicos. Procedeu-se à análise genética, utilizando-se o ciclo parassexual (heterocário, diplóides e segregantes haplóides). Determinou-se o número de núcleos em conídios, bem como a produção de aflatoxina das linhagens originais, diplóides, segregantes e mutantes. Pelos resultados obtidos, as seguintes conclusões podem ser tiradas: a) Puderam ser obtidos mutantes pelo emprego de luz ultravioleta. Foram obtidos, com sucesso, mutantes morfológicos e auxotróficos (aminoácidos, vitaminas e purinas). b) Foram obtidos heterocários entre linhagens de diferentes origens, o que indica serem elas compatíveis. Também puderam ser obtidos diplóides entre linhagens diferentes. c) O número de núcleos presentes em conídios foi variado, aparecendo conídios com até quatro núcleos. Em diploides, existe uma tendência para a ocorrência de conídios uninucleados e binucleados. d) O caráter produção de aflatoxina em A. flavus, revelou ser complexo e, possivelmente, muitos genes devem estar envolvidos.The present work was carried out aiming the study of aspects related to the parasexual cycle and aflatoxin production in Aspergillus flavus. Three strains of A. flavus isolated from peanuts (A5a, A6e and B2d) were used. Auxotrophic and morphologycal mutants were obtained. Genetic analysis was carried out through the parasexual cycle (heterokaryon, diploids and haploid segregants). The nuclei number of conidia was determined as well the aflatoxin production of original, mutant, diploid and segregant strains. From the obtained results the following conclusions can be drawn: a - Mutants can be obtained by the use of ultraviolet light, Auxotrophic (Aminoacids, vitamins and purine mutants) and morphologycal mutants were obtained. b - Heterokaryons were obtained between strain of different origins which indicate that they are compatible. Diploids were also obtained between such strains. c - The number of nuclei present in conidia varied. Conidia with four nuclei were obtained. In diploids there is a tendency towards uninucleate and binucleated conidia. d - The production of aflatoxin in A. flavus is a complex character, possibly due to several genes

Fungos, sua utilização para controle de insetos de importância médica e agrícola

575

Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S- ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E9, B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E9, B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae