Developing new smallpox vaccines.

New stockpiles of smallpox vaccine are required as a contingency for protecting civilian and military personnel against deliberate dissemination of smallpox virus by terrorists or unfriendly governments. The smallpox vaccine in the current stockpile consists of a live animal poxvirus (Vaccinia virus [VACV]) that was grown on the skin of calves. Because of potential issues with controlling this earlier manufacturing process, which included scraping VACV lesions from calfskin, new vaccines are being developed and manufactured by using viral propagation on well-characterized cell substrates. We describe, from a regulatory perspective, the various strains of VACV, the adverse events associated with calf lymph-propagated smallpox vaccine, the issues regarding selection and use of cell substrates for vaccine production, and the issues involved in demonstrating evidence of safety and efficacy

Genome Sequence of Erythromelalgia-Related Poxvirus Identifies it as an Ectromelia Virus Strain

Erythromelagia is a condition characterized by attacks of burning pain and inflammation in the extremeties. An epidemic form of this syndrome occurs in secondary students in rural China and a virus referred to as erythromelalgia-associated poxvirus (ERPV) was reported to have been recovered from throat swabs in 1987. Studies performed at the time suggested that ERPV belongs to the orthopoxvirus genus and has similarities with ectromelia virus, the causative agent of mousepox. We have determined the complete genome sequence of ERPV and demonstrated that it has 99.8% identity to the Naval strain of ectromelia virus and a slighly lower identity to the Moscow strain. Small DNA deletions in the Naval genome that are absent from ERPV may suggest that the sequenced strain of Naval was not the immediate progenitor of ERPV

Drosophila S2 Cells Are Non-Permissive for Vaccinia Virus DNA Replication Following Entry via Low pH-Dependent Endocytosis and Early Transcription

Vaccinia virus (VACV), a member of the chordopox subfamily of the Poxviridae, abortively infects insect cells. We have investigated VACV infection of Drosophila S2 cells, which are useful for protein expression and genome-wide RNAi screening. Biochemical and electron microscopic analyses indicated that VACV entry into Drosophila S2 cells depended on the VACV multiprotein entry-fusion complex but appeared to occur exclusively by a low pH-dependent endocytic mechanism, in contrast to both neutral and low pH entry pathways used in mammalian cells. Deep RNA sequencing revealed that the entire VACV early transcriptome, comprising 118 open reading frames, was robustly expressed but neither intermediate nor late mRNAs were made. Nor was viral late protein synthesis or inhibition of host protein synthesis detected by pulse-labeling with radioactive amino acids. Some reduction in viral early proteins was noted by Western blotting. Nevertheless, synthesis of the multitude of early proteins needed for intermediate gene expression was demonstrated by transfection of a plasmid containing a reporter gene regulated by an intermediate promoter. In addition, expression of a reporter gene with a late promoter was achieved by cotransfection of intermediate genes encoding the late transcription factors. The requirement for transfection of DNA templates for intermediate and late gene expression indicated a defect in viral genome replication in VACV-infected S2 cells, which was confirmed by direct analysis. Furthermore, VACV-infected S2 cells did not support the replication of a transfected plasmid, which occurs in mammalian cells and is dependent on all known viral replication proteins, indicating a primary restriction of DNA synthesis

Intramolecular homologous recombination in cells infected with temperature-sensitive mutants of vaccinia virus

I have used a plasmid containing two copies of the Saccharmyces cerevisiae his3 gene to study intramolecular homologous recombination in vaccina virus-infected cells. Recombination of the plasmid was monitored by restriction enzyme digestion and Southern blot hybridization in cells infected with representatives from each of 32 complementation groups of temperature-sensitive mutants ts42 and ts17 did not replicate nor detectably recombine the input plasmid. All except one of the mutants that synthesized normal amounts of viral DNA and protein replicated and recombined the plasmid in a manner indistinguishable from wild-type virus. The remaining mutant, ts13, only poorly replicated and recombined the input plasmid. Thus, the processes of replication and recombination could not be separated by using this battery of mutants. Viral mutants defective in late protein synthesis were unable to resolve the vaccinia virus concatemer junction in plasmids but carried out intramolecular homologous recombination with plasmids as efficiently as did wild-type virus at the conditionally lethal temperature. This result distinguishes homologous recombination, which requires early gene products, from resolution of concatemer junctions, which requires additional late gene products.</jats:p

Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses

In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.</jats:p

Resolution of poxvirus telomeres: processing of vaccinia virus concatemer junctions by conservative strand exchange

The replication of vaccinia virus proceeds through concatemeric intermediates which are resolved into unit-length DNA. In vaccinia virus-infected cells, plasmids containing the vaccinia virus DNA junction fragment that connects concatemers are resolved into linear minichromosomes of vector DNA flanked by hairpin loops. Resolution requires two copies of a specific nucleotide sequence conserved among poxviruses and found proximal to the hairpin loop. This study demonstrates that orientation of each sequence with respect to the other as well as to the axis of symmetry is critical for resolution, the processing of plasmids containing heterologous pairs of resolution sites is influenced by mismatched nucleotides between the sites, and the vaccinia virus hairpin in the linear minichromosome is a heteroduplex composed of DNA from each strand of the concatemer junction. A model incorporating site-specific recombination and orientated branch migration is proposed to account for resolution of the vaccinia virus concatemer junction.</jats:p

Resolution of vaccinia virus DNA concatemer junctions requires late-gene expression

Vaccinia virus replicates in the cytoplasm of infected cells, generating transient replicative intermediates containing the DNA for the terminal sequences as concatemeric junctions. The processing of the terminal sequences for a series of vaccinia virus conditional lethal mutants at the nonpermissive temperature was analyzed by restriction enzyme digestion and Southern blot hybridization of DNA isolated from infected cells. Three phenotypes were observed: DNA replication negative (Rep-), DNA replication positive but concatemer resolution negative (Rep+ Res-), and DNA replication positive and concatemer resolution positive (Rep+ Res+). Interestingly, all six Rep+ Res- mutants from separate complementation groups were defective in late protein synthesis. Isatin beta-thiosemicarbazone, a drug that blocks late protein synthesis, also prevented resolution of concatemers. Orthogonal field gel electrophoresis of the DNA generated by the late defective mutants revealed a distribution of linear genome multimers. The multimers were processed into mature monomers after a shift to the permissive temperature in the presence of cytosine arabinoside for all the Rep+ Res- mutants except ts22, an irreversible mutant which cleaves RNA late in infection (R.F. Pacha and R.C. Condit, J. Virol. 56:395-403, 1985). Genome formation can be divided into two stages: DNA replication, which generates concatemers, and resolution, which processes concatemers into monomers with hairpin termini. Early viral genes are required for the former, and late viral genes are required for the latter.</jats:p

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.</jats:p