Mutational analysis of the resolution sequence of vaccinia virus DNA: essential sequence consists of two separate AT-rich regions highly conserved among poxviruses

Abstract

In replicative forms of vaccinia virus DNA, the unit genomes are connected by palindromic junction fragments that are resolved into mature viral genomes with hairpin termini. Bacterial plasmids containing the junction fragment for vaccinia virus or Shope fibroma virus were converted into linear minichromosomes of vector sequence flanked by poxvirus hairpin loops after transfection into infected cells. Analysis of a series of symmetrical deletion mutations demonstrated that in vaccinia virus the presence of the DNA sequence ATTTAGTGTCTAGAAAAAAA on both sides of the apical segment of the concatemer junction is crucial for resolution. To determine the precise architecture of the resolution site, a series of site-directed mutations within this tract of nucleotides were made and the relative contribution of each nucleotide to the efficaciousness of resolution was determined. The nucleotide sequence necessary for the resolution of the vaccinia virus concatemer junction, (A/T)TTT(A/G)N7-9AAAAAAA, is highly conserved among poxviruses and found proximal to the hairpin loop in the genomes of members of the Leporipoxvirus, Avipoxvirus, and Capripoxvirus genera.</jats:p

    Similar works

    Full text

    thumbnail-image

    Available Versions