Differences in Transcriptional Activity of Human Papillomavirus Type 6 Molecular Variants in Recurrent Respiratory Papillomatosis

<div><p>A significant proportion of recurrent respiratory papillomatosis (RRP) is caused by human papillomavirus type 6 (HPV-6). The long control region (LCR) contains cis-elements for regulation of transcription. Our aim was to characterize LCR HPV-6 variants in RRP cases, compare promoter activity of these isolates and search for cellular transcription factors (TFs) that could explain the differences observed. The complete LCR from 13 RRP was analyzed. Transcriptional activity of 5 variants was compared using luciferase assays. Differences in putative TFs binding sites among variants were revealed using the TRANSFAC database. Chromatin immunoprecipation (CHIP) and luciferase assays were used to evaluate TF binding and impact upon transcription, respectively. Juvenile-onset RRP cases harbored exclusively HPV-6vc related variants, whereas among adult-onset cases HPV-6a variants were more prevalent. The HPV-6vc reference was more transcriptionally active than the HPV-6a reference. Active FOXA1, ELF1 and GATA1 binding sites overlap variable nucleotide positions among isolates and influenced LCR activity. Furthermore, our results support a crucial role for ELF1 on transcriptional downregulation. We identified TFs implicated in the regulation of HPV-6 early gene expression. Many of these factors are mutated in cancer or are putative cancer biomarkers, and must be further studied.</p></div

Phylogenetic analysis of DENV-2 based on the complete genome sequence.

<p>The evolutionary history was inferred using the Maximum Likelihood method, using the General Time Reversible model for nucleotide substitution with discrete Gamma distribution to model evolutionary rate differences among sites [4 categories (+<i>G</i>, parameter = 0.45)]. The tree with the highest log likelihood (−46330.60) is shown. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 91 nucleotide sequences with a total of 10,167 positions in the final dataset. A total of 1000 bootstrap replicates were run and values ≥99 are represented as percentage in respective nodes. The Brazilian DENV-2 lineages are shown in grey. For clarity purposes some branches were collapsed. VE/CO/GU/BZ/MX 1999–2009 contains isolates from Venezuela (VE61095/2007, DENV-2/VE/BID-V2944/2005, -V2424/2004, -V2492/200, -V2216/2003, -V2262/2006), Colombia (DENV-2/CO/BID-V3370/2004, -V3369/1999, -V1603/2004), Guatemala (FDA-GUA09/2009), Belize (BZ/BID-V2952/2002) and Mexico (DENV-2MX/BID-V3661, -V3714 and –V3768); PR 1986–1995 contains isolates from Puerto Rico (DENV-2/US/BID-V1356/1993, -V855/1992, -V1182/1989, -V1175/1988, -V1183/1990, -V1171/1987, -V1164/1986, DENV-2/PR/17DN/1995 and DENV-2/PR/6780DN/1994 ) and PR 1994–2007 also contains isolates from Puerto Rico (DENV-2/US/BID-V37DN/1994, -V1424/1996, -V1427/1999, -V1398/1997, -V1038/1998, -V1367/1995, -V1463/2000, V1472/2001, -V593/2005 and –V1412/2007). Evolutionary analyses were conducted in MEGA5.0.</p

Amino acid differences in the envelope protein of Brazilian DENV-2 lineages.

1<p>- except HQ012515.BR59382/RN/1997 and HQ012518.BR66985/RJ/2000 (K).</p>2<p>- except DENV-2/BR/BID-V2386/2003, DENV-2/BR/BID-V2396/2006, JF804028.BR/DB015/2006 (V).</p

Bayesian coalescent and discrete phylogeography analyses of Brazilian DENV-2 based on envelope nucleotide sequence.

<p>Subtree of the maximum clade credibility tree was inferred using 144 DENV-2 envelope sequences (1,485 nt). The subtree containing isolates of the American/Asian genotype is displayed here. Time of the most recent common ancestor (MRCA) was estimated using the year of isolation as the calibration point, under the relaxed molecular clock, with the Tamura Nei Model, with discrete Gamma distribution and an estimated nucleotide substitution rate of 7.5⁻⁴. The posterior probabilities values ≥0.96 are represented by (*) and values ≥0.99 are represented by (**), inside the nodes. The years that the MRCA was estimated to exist are shown for some nodes with upper and lower intervals in parenthesis. The origin value of the reverse scale axis corresponds to year 2010. Using different colors, (legend shown on the left side), terminal branches were annotated based on geographic location of DENV-2 isolates. Internal nodes of the tree which presented modal state posterior probability ≥0.60 were also colored according to their most probable location states, inferred by discrete phylogeographical analysis. Brazilian lineages are delimited by square brackets. For clarity purposes some branches were collapsed. SJRP/2008 contains 11 isolates from São José do Rio Preto/São Paulo/Brazil (DENV-2/BR/BID-V3653/2008, -V3638/2008, -V3640/2008, -V3483/2008, -V3637/2008, -V3495/2008, -V3645/2008, -V3481/2008, -V3486/2008, -V3650/2008 and -V3648/2008); CU/US/KN 1997–2001 contains isolates from Cuba (Cuba115/97 and Cuba165/1997), Puerto Rico (US/BIC-V1387/1998) and Saint Kitts and Nevis (KN/BID-V2951/2001); VE/CO/GU/BZ/MX 1999–2009; PR 1986–1995 and PR 1994–2007 contain the same isolates as described in the <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0059422#pone-0059422-g001" target="_blank">Figure 1</a> caption. Analyses were performed using programs from BEAST package v.1.6.1, BEAUTi, Tracer v.1.5.0, TreeAnotator v.1.6.1 and FigTree v.1.3.1 (B) Map of Brazil showing the macro-regions and states. The black pin indicates the approximate location of São José do Rio Preto/São Paulo/Brazil.</p

Clinical data of recurrent respiratory papillomatosis (RRP) patients harboring human papillomavirus type -6a and -6vc (HPV-6a and -6vc) related variants.

<p>Abbreviations: JORRP, juvenile onset recurrent respiratory papillomatosis; AORRP adult onset recurrent respiratory papillomatosis.</p><p>^a Fisher's exact test.</p><p>^b T-test.</p><p>Clinical data of recurrent respiratory papillomatosis (RRP) patients harboring human papillomavirus type -6a and -6vc (HPV-6a and -6vc) related variants.</p

Binding and activity of ELF1 and FOXA1 to HPV-6vc-ref and HPV-6vc-var1.

<p>Luciferase reporter assay for (A) ELF1 and (B) FOXA1. (C) Amplification of LCR fragments following chromatin immunoprecipitation (ChIP) using primers surrounding nucleotide position 7626 that differs among HPV-vc-ref and HPV-6vc-var1 variants. Input-nonimmunoprecipated samples.</p

Nucleotide sequence variability within the long control region (LCR) of human papillomavirus type 6 (HPV-6) molecular variants.

<p>Genomic positions containing specific mutations are indicated vertically across the top. Genomic positions without mutations compared to the HPV-6a-ref sequence (·), Insertions (I): I1 = TTATTGTATATCTTGTTACA; I2 = C nucleotide insertion.</p><p>Nucleotide sequence variability within the long control region (LCR) of human papillomavirus type 6 (HPV-6) molecular variants.</p

Binding and activity of ELF1 and GATA1 to HPV-6a-ref and HPV-6a-var1.

<p>Luciferase reporter assay for (A) ELF1 and (B) GATA1. (C) Amplification of LCR fragments following chromatin immunoprecipitation (ChIP) using primers surrounding nucleotide position 16 that differs among HPV-6a-ref and HPV-6a-var1 variants. Input-nonimmunoprecipated samples.</p

Binding and activity of ELF1, GATA1 and FOXA1 to HPV-6a-ref and HPV-6vc-ref.

<p>(A) Luciferase reporter assay for GATA1. Amplification of LCR fragments following chromatin immunoprecipitation (ChIP) using primers surrounding nucleotide position (B) 7631/33 and (C) 7762 and that differ between HPV-6a-ref and HPV-6vc-var1 variants. Input-nonimmunoprecipated samples.</p

Molecular variants of HPV-6 differ in early promoter activity.

<p>(A) Transcriptional activity of human papillomavirus type (HPV-6) molecular variants isolated from recurrent respiratory papillomatosis (RRP) cases. Data are presented as mean ± SD relative values from 3 independent experiments. Transcriptional activity was normalized to that of HPV-6a-ref which was arbitrarily defined as the reference and set to value 1. Kruskal-Wallis and Tukey’s tests were used to compare LCR activity among the different HPV-6 molecular variants. Asterisks indicate isolates that showed statistically significant different transcriptional activities compared to the corresponding references (HPV-6a-ref or HPV-6vc-ref). (P<0.001). (B) Putative cellular transcription factors binding sites within the long control region (LCR) that differ among the different molecular variants of human papillomavirus (HPV) type 6 detected.</p