Late coronary occlusion after intracoronary brachytherapy

BACKGROUND: Intracoronary brachytherapy appears to be a promising technology to prevent restenosis. Presently, limited data are available regarding the late safety of this therapeutic modality. The aim of the study was to determine the incidence of late (>1 month) thrombosis after PTCA and radiotherapy. METHODS AND RESULTS: From April 1997 to March 1999, we successfully treated 108 patients with PTCA followed by intracoronary beta-radiation. Ninety-one patients have completed at least 2 months of clinical follow-up. Of these patients, 6.6% (6 patients) presented with sudden thrombotic events confirmed by angiography 2 to 15 months after intervention (2 balloon angioplasty and 4 stent). Some factors (overlapping stents, unhealed dissection) may have triggered the thrombosis process, but the timing of the event is extremely unusual. Therefore, the effect of radiation on delaying the healing process and maintaining a thrombogenic coronary surface is proposed as the most plausible mechanism to explain such late events. CONCLUSIONS: Late and sudden thrombosis after PTCA followed by intracoronary radiotherapy is a new phenomenon in interventional cardiology

Geographic miss: a cause of treatment failure in radio-oncology applied to intracoronary radiation therapy

BACKGROUND: A recognized limitation of endovascular beta-radiation therapy is the development of new stenosis at the edges of the irradiated area. The combination of injury and low-dose radiation may be the precursor of this phenomenon. We translated the radio-oncological concept of "geographic miss" to define cases in which the radiation source did not fully cover the injured area. The aims of the study were to determine the incidence and causes of geographic miss and evaluate the impact of this inadequate treatment on the outcome of patients treated with intracoronary beta-radiation. METHODS AND RESULTS: We analyzed 50 consecutive patients treated with beta-radiation after percutaneous coronary intervention. The prescribed dose ranged between 12 and 20 Gy at 2 mm from the source axis. By means of quantitative coronary angiography, the irradiated segment (IRS) and both edges were studied before and after intervention and at 6-month follow-up. Edges that were injured during the procedure constituted the geographic miss edges. Twenty-two edges were injured during the intervention, mainly because of procedural complications that extended the treatment beyond the margins of the IRS. Late loss was significantly higher in geographic miss edges than in IRSs and uninjured edges (0.84+/-0.6 versus 0.15+/-0.4 and 0.09+/-0.4 mm, respectively; P<0.0001). Similarly, restenosis rate was significantly higher in the injured edges (10% within IRS, 40.9% in geographic miss edges, and 1.9% in uninjured edges; P<0.001). CONCLUSIONS: These data support the hypothesis that the combination of injury and low-dose beta-radiation induces deleterious outcome

Geographic Miss

Background—A recognized limitation of endovascular ß-radiation therapy is the development of new stenosis at the edges of the irradiated area. The combination of injury and low-dose radiation may be the precursor of this phenomenon. We translated the radio-oncological concept of "geographic miss" to define cases in which the radiation source did not fully cover the injured area. The aims of the study were to determine the incidence and causes of geographic miss and evaluate the impact of this inadequate treatment on the outcome of patients treated with intracoronary ß-radiation. Methods and Results—We analyzed 50 consecutive patients treated with ß-radiation after percutaneous coronary intervention. The prescribed dose ranged between 12 and 20 Gy at 2 mm from the source axis. By means of quantitative coronary angiography, the irradiated segment (IRS) and both edges were studied before and after intervention and at 6-month follow-up. Edges that were injured during the procedure constituted the geographic miss edges. Twenty-two edges were injured during the intervention, mainly because of procedural complications that extended the treatment beyond the margins of the IRS. Late loss was significantly higher in geographic miss edges than in IRSs and uninjured edges (0.84±0.6 versus 0.15±0.4 and 0.09±0.4 mm, respectively; P<0.0001). Similarly, restenosis rate was significantly higher in the injured edges (10% within IRS, 40.9% in geographic miss edges, and 1.9% in uninjured edges; P<0.001). Conclusions—These data support the hypothesis that the combination of injury and low-dose ß-radiation induces deleterious outcome

Positive geometric vascular remodeling is seen after catheter-based radiation followed by conventional stent implantation but not after radioactive stent implantation

BACKGROUND: Recent reports demonstrate that intracoronary radiation affects not only neointimal formation but also vascular remodeling. Radioactive stents and catheter-based techniques deliver radiation in different ways, suggesting that different patterns of remodeling after each technique may be expected. METHODS AND RESULTS: We analyzed remodeling in 18 patients after conventional stent implantation, 16 patients after low-activity radioactive stent implantation, 16 patients after higher activity radioactive stent implantation, and, finally, 17 patients who underwent catheter-based radiation followed by conventional stent implantation. Intravascular ultrasound with 3D reconstruction was used after stent implantation and at the 6-month follow-up to assess remodeling within the stent margins and at its edges. Preprocedural characteristics were similar between groups. In-stent neointimal hyperplasia (NIH) was inhibited by high-activity radioactive stent implantation (NIH 9.0 mm(3)) and by catheter-based radiation followed by conventional stent implantation (NIH 6.9 mm(3)) compared with low-activity radioactive stent implantation (NIH 21.2 mm(3)) and conventional stent implantation (NIH 20.8 mm(3)) (P:=0.008). No difference in plaque or total vessel volume was seen behind the stent in the conventional, low-activity, or high-activity stent implantation groups. However, significant increases in plaque behind the stent (15%) and in total vessel volume (8%) were seen in the group that underwent catheter-based radiation followed by conventional stent implantation. All 4 groups demonstrated significant late lumen loss at the stent edges; however, edge restenosis was seen only in the group subjected to high-activity stent implantation and appeared to be due to an increase in plaque and, to a lesser degree, to negative remodeling. CONCLUSIONS: Distinct differences in the patterns of remodeling exist between conventional, radioactive, and catheter-based radiotherapy with stenting

Preserved endothelium-dependent vasodilation in coronary segments previously treated with balloon angioplasty and intracoronary irradiation

BACKGROUND: Abnormal endothelium-dependent coronary vasomotion has been reported after balloon angioplasty (BA), as well as after intracoronary radiation. However, the long-term effect on coronary vasomotion is not known. The aim of this study was to evaluate the long-term vasomotion of coronary segments treated with BA and brachytherapy. METHODS AND RESULTS: Patients with single de novo lesions treated either with BA followed by intracoronary beta-irradiation (according to the Beta Energy Restenosis Trial-1.5) or with BA alone were eligible. Of these groups, those patients in stable condition who returned for 6-month angiographic follow-up formed the study population (n=19, irradiated group and n=11, control group). Endothelium-dependent coronary vasomotion was assessed by selective infusion of serial doses of acetylcholine (ACh) proximally to the treated area. Mean luminal diameter was calculated by quantitative coronary angiography both in the treated area and in distal segments. Endothelial dysfunction was defined as a vasoconstriction after the maximal dose of ACh (10(-6) mol/L). Seventeen irradiated segments (89.5%) demonstrated normal endothelial function. In contrast, 10 distal nonirradiated segments (53%) and 5 control segments (45%) demonstrated endothelium-dependent vasoconstriction (-19+/-17% and -9.0+/-5%, respectively). Mean percentage of change in mean luminal diameter after ACh was significantly higher in irradiated segments (P=0.01). CONCLUSIONS: Endothelium-dependent vasomotion of coronary segments treated with BA followed by beta-radiation is restored in the majority of stabl

Outcome from balloon induced coronary artery dissection after intracoronary beta radiation

OBJECTIVE: To evaluate the healing of balloon induced coronary artery dissection in individuals who have received beta radiation treatment and to propose a new intravascular ultrasound (IVUS) dissection score to facilitate the comparison of dissection through time. DESIGN: Retrospective study. SETTING: Tertiary referral centre. PATIENTS: 31 patients with stable angina pectoris, enrolled in the beta energy restenosis trial (BERT-1.5), were included. After excluding those who underwent stent implantation, the evaluable population was 22 patients. INTERVENTIONS: Balloon angioplasty and intracoronary radiation followed by quantitative coronary angiography (QCA) and IVUS. Repeat QCA and IVUS were performed at six month follow up. MAIN OUTCOME MEASURES: QCA and IVUS evidence of healing of dissection. Dissection classification for angiography was by the National Heart Lung Blood Institute scale. IVUS proven dissection was defined as partial or complete. The following IVUS defined characteristics of dissection were described in the affected coronary segments: length, depth, arc circumference, presence of flap, and dissection score. Dissection was defined as healed when all features of dissection had resolved. The calculated dose of radiation received by the dissected area in those with healed versus non-healed dissection was also compared. RESULTS: Angiography (type A = 5, B = 7, C = 4) and IVUS proven (partial = 12, complete = 4) dissections were seen in 16 patients following intervention. At six month follow up, six and eight unhealed dissections were seen by angiography (A = 2, B = 4) and IVUS (partial = 7, complete = 1), respectively. The mean IVUS dissection score was 5.2 (range 3-8) following the procedure, and 4.6 (range 3-7) at follow up. No correlation was found between the dose prescribed in the treated area and the presence of unhealed disse

Association of Bevacizumab Plus Oxaliplatin-Based Chemotherapy With Disease-Free Survival and Overall Survival in Patients With Stage II Colon Cancer A Secondary Analysis of the AVANT Trial

IMPORTANCE: In the pivotal Bevacizumab-Avastin Adjuvant (AVANT) trial, patients with high-risk stage II colon cancer (CC) had 5-year and 10-year overall survival (OS) rates of 88% and 75%, respectively, with adjuvant fluorouracil and oxaliplatin-based chemotherapy; however, the trial did not demonstrate a disease-free survival (DFS) benefit of adding bevacizumab to oxaliplatin-based chemotherapy in stage III CC and suggested a detrimental effect on OS. The Long-term Survival AVANT (S-AVANT) study was designed to collect extended follow-up for patients in the AVANT trial. OBJECTIVE: To explore the efficacy of adjuvant bevacizumab combined with oxaliplatin-based chemotherapy in patients with high-risk, stage II CC. DESIGN, SETTING, AND PARTICIPANTS: This prespecified secondary end point analysis of the AVANT and S-AVANT studies included 573 patients with curatively resected high-risk stage II CC and at least 1 of the following criteria: stage T4, bowel obstruction or perforation, blood and/or lymphatic vascular invasion and/or perineural invasion, age younger than 50 years, or fewer than 12 nodes analyzed. The AVANT study was a multicenter randomized stage 3 clinical trial. Data were collected from December 2004 to February 2019, and data for this study were analyzed from March to September 2019. INTERVENTION: Patients were randomly assigned to receive 5-fluorouracil, leucovorin, and oxaliplatin (FOLFOX4), FOLFOX4 with bevacizumab, or capecitabine and oxaliplatin (XELOX) with bevacizumab. MAIN OUTCOMES AND MEASURES The primary end points of this secondary analysis were DFS and OS in patients with high-risk stage II CC. RESULTS The AVANT study included 3451 patients, of whom 573 (16.6%) had high-risk stage II CC (192 [33.5%] randomized to FOLFOX4 group; 194 [33.9%] randomized to FOLFOX4 with bevacizumab group; 187 [32.6%] randomized to XELOX with bevacizumab group). With a median (interquartile range) age of 57.0 (47.2-65.7) years, the study population comprised 325 men (56.7%) and 248 women (43.3%). After a median (interquartile range) follow-up of 6.9 (6.1-11.3) years, the 3-year DFS and 5-year OS rates were 88.2% (95% CI, 83.7%-93.0%) and 89.7% (95% CI, 85.4%-94.2%) in the FOLFOX4 group, 86.6% (95% CI, 81.8%-91.6%) and 89.7% (95% CI, 85.4%-94.2%) in the FOLFOX4 with bevacizumab group, and 86.7% (95% CI, 81.8%-91.8%) and 93.2% (95% CI, 89.6%-97.0%) in the XELOX with bevacizumab group, respectively. The DFS hazard ratio was 0.94 (95% CI, 0.59-1.48; P = .78) for FOLFOX4 with bevacizumab vs FOLFOX4 and 1.07 (95% CI, 0.69-1.67; P = .76) for XELOX with bevacizumab vs FOLFOX4. The OS hazard ratio was 0.92 (95% CI, 0.55-1.55; P = .76) for FOLFOX4 with bevacizumab vs FOLFOX4 and 0.85 (95% CI, 0.50-1.44; P = .55) for XELOX with bevacizumab vs FOLFOX4. CONCLUSIONS AND RELEVANCE: In this secondary analysis of data from the AVANT trial, adding bevacizumab to oxaliplatin-based chemotherapy was not associated with longer DFS or OS in patients with high-risk stage II CC. The findings suggest that the definition of high-risk stage II CC needs to be revisited

EPILEPSIE ET HAMARTOME HYPOTHALAMIQUE (A PROPOS DE 14 CAS)

LYON1-BU Santé (693882101) / SudocPARIS-BIUM (751062103) / SudocSudocFranceF

Data from: Optimizing detectability of the endangered fan mussel using eDNA and ddPCR

&lt;p&gt;Spatial and temporal monitoring of species threatened with extinction is of critical importance for conservation and ecosystem management. On the Mediterranean coast, the fan mussel (&lt;em&gt;Pinna nobilis&lt;/em&gt;) is listed as critically endangered after suffering from a mass mortality event since 2016, leading to 100% mortality in most marine populations. Conventional monitoring for this macroinvertebrate is done using scuba, which is challenging in dense meadows or with low visibility. Here we developed an environmental DNA assay targeting the fan mussel and assessed the influence of several environmental parameters on the species detectability &lt;em&gt;in situ&lt;/em&gt;. We developed and tested an eDNA molecular marker and collected 48 water samples in two sites at the Thau lagoon (France) with distinct fan mussel density, depths, and during two seasons (summer and autumn). Our marker can amplify fan mussel DNA but lacks specificity since it also amplifies a conspecific species (&lt;em&gt;Pinna rudis&lt;/em&gt;). We successfully amplified fan mussel DNA from &lt;em&gt;in situ&lt;/em&gt; samples with 46 positive samples (out of 48) using ddPCR, although the DNA concentrations measured were low over almost all samples. Deeper sampling depth slightly increased DNA concentrations, but no seasonal effect was found. We highlight a putative spawning event on a single summer day with much higher DNA concentration compared to all other samples. We present an eDNA molecular assay able to detect the endangered fan mussel and provide guidelines to optimize the sampling protocol to maximize detectability. Effective and non-invasive monitoring tools for endangered species are promising to monitor remaining populations and have the potential for ecological restoration or habitat recolonisation following a mass mortality event.&lt;/p&gt;&lt;p&gt;Funding provided by: FEDER&lt;br&gt;Crossref Funder Registry ID: http://dx.doi.org/10.13039/501100002924&lt;br&gt;Award Number: CONAQUAT&lt;/p&gt;&lt;ul&gt; &lt;li&gt;Assay development&lt;/li&gt; &lt;/ul&gt; &lt;p&gt;Reference sequences on the mitochondrial genome were downloaded for &lt;em&gt;P.nobilis&lt;/em&gt; and co-occurring related species of the same family (&lt;em&gt;Pinna rudis&lt;/em&gt; and &lt;em&gt;Atrina fragilis&lt;/em&gt;) from EMBL (Kanz et al. 2005), and aligned using Geneious Prime 2020 (&lt;a href="https://www.geneious.com/"&gt;https://www.geneious.com/&lt;/a&gt;). Primer selection was done by maximizing specificity on the binding sites for the target species while maximizing the number of mismatches of ligation sites of closely related species. Primers were designed manually with the assistance of the primer3 algorithm on Geneious and amplified a sequence insert of ~202 bp on the mitochondrial COI gene for &lt;em&gt;P.nobilis (Supl Mat Table S1)&lt;/em&gt;, the full amplified sequence being ~243 pb. The selected primer pair (PN_COI_M15; forward-TCAGCTTTTGTAGAGGGCGG; reverse- AGAGACTACCAACAGCACAGC) was also tested on the entire NCBI database using in-silico PCR with the ecoPCR software (Boyer et al., 2016) allowing up to 3 mismatches on each primer (so 6 in total), to verify the absence of unrelated species cross-amplification. Additionally, a probe (PN_COIM15-Probe; FAM-5' TGGATTTGTTCCCTTGGGCTGTTC 3'- BHQ1) was designed to enhance specificity using the Primer3Plus software (Untergasser et al. 2012).&lt;/p&gt; &lt;ul&gt; &lt;li&gt;Sampling for eDNA&lt;/li&gt; &lt;/ul&gt; &lt;p&gt;DNA sampling aimed to first collect live fan mussel from an aquarium and then sample water in real field condition in a Mediterranean lagoon with known populations of fan mussel.&lt;/p&gt; &lt;p&gt;We sampled water in the field with known presence and densities of fan mussels in the Thau lagoon (Sète, France) (Foulquie et al. 2020), one of the last known locations to harbor healthy mussel populations in France. Sampling sites were chosen from the study of Foulquie et al. (2020) which assessed fan mussel densities in several sites around the lagoon 3 months prior to our sampling. We selected sites with at least 3m of depth and varying densities: the Barrou (~9 ind/100m&lt;sup&gt;2&lt;/sup&gt;) and the Sete Canal (~4 ind/100m&lt;sup&gt;2&lt;/sup&gt;) (Fig. 1). Maximum depth of those sites was ~2.5m. We filtered water from a boat using the same pump and settings as for the aquaria samples but made linear transects of ~300m over the site area, for a total of 30L per sample. Transects were made at low speed (5 knots) and by going back and forth to remain in the area, with one pump on each side of the boat and using disposable tubing and gloves. Surface samples were done at ~0.5m of the surface with short tubes, and deeper samples were done to target the benthos using 3m-long weighted tubes. We chose to sample seasonally during Summer and Autumn to encompass various environmental conditions and test a potential effect of the reproduction period, known to occur during the summer months. We collected a total of 48 samples, with 24 samples over two days in summer in July (2020-07-27 and 2020-07-30), and 24 samples over two days in autumn in October (2020-10-20 and 2020-10-21). Each day, 12 samples were collected spanning both sites and two sampling depths (bottom and surface), so that three replicates were obtained for each site-depth combination.&lt;/p&gt; &lt;ul&gt; &lt;li&gt;eDNA extraction and amplification by ddPCR&lt;/li&gt; &lt;/ul&gt; &lt;p&gt;&lt;strong&gt;DNA extraction&lt;/strong&gt;&lt;/p&gt; &lt;p&gt;DNA extraction was performed at SPYGEN (Le Bourget du Lac, France) following the protocol described in Polanco Fernández et al., (2020), in a dedicated lab for eDNA extraction with UV treatment and positive air pressure. Briefly, each capsule was agitated for 15 min on an S50 shaker (cat Ingenieurbüro™) at 800 rpm. The buffer was then emptied into two 50-ml tubes before being centrifuged for 15 min at 15,000 g. The supernatant was removed with a sterile pipette, leaving 15 ml of liquid at the bottom of each tube. Then, 33 ml of ethanol and 1.5 ml of 3 M sodium acetate were added to each 50-ml tube and stored for at least one night at −20°C. The tubes were centrifuged at 15,000 g for 15 min at 6°C, and the supernatants were discarded. After this step, 720 μl of ATL buffer from Qiagen Blood and Tissue Kit(Qiagen GmbH) was added to each tube. Each tube was then vortexed, and the supernatant was transferred to a 2-ml tube containing 20 μl of Proteinase K. The tubes were finally incubated at 56°C for 2 hr. Subsequently, DNA extraction was performed using NucleoSpin® Soil (MACHEREY-NAGEL GmbH &amp; Co.) starting from step 6 and following the manufacturer's instructions, and two DNA extractions were carried out per filtration capsule. The elution was performed by adding 100 μl of SE buffer twice. The two DNA samples were pooled before the amplification step. After the DNA extraction, the samples were tested for inhibition by qPCR (Biggs et al. 2015). If the sample was considered inhibited, it was diluted 5-fold before amplification.&lt;/p&gt; &lt;p&gt;&lt;strong&gt;Amplification with ddPCR&lt;/strong&gt;&lt;/p&gt; &lt;p&gt;ddPCRs were run with a BioRad QX200 Droplet Digital PCR system™ (Bio-Rad, Temse, Belgium). Each 22 μl ddPCR reaction mix contained 1× Bio-Rad ddPCR supermix for probes (no dUTP), 900 nM forward primer, 900 nM reverse primer, 250 nM probe, 2,5 μl template, and 3,99 μl H20. ddPCR reaction was placed in a QX200 Droplet Generator to generate approximately 20000 droplets in which independent PCR reactions occur.PCR was performed with the following thermal conditions: 95°C for 10 min followed by 40 cycles of 95°C for 30s and 58°C for 1 min; and 98°C for 10 min and 4°C for 30 min. Optimal annealing temperature (58°C) was determined based on an initial thermal gradient experiment testing temperatures from 54 to 64°C. Droplets were then read on a QX200 droplet reader (Bio-Rad). Each run included 3 PCR positive and 3 PCR negative controls and samples were tested in triplicate (N=3). QuantaSoft software was used to count the PCR-positive and PCR-negative droplets and to provide absolute quantification of target DNA. The baseline threshold for separating positive and negative droplets was manually chosen per run, based on the distribution of the negative droplets from the negative control wells. The quantification measurements of each target were expressed as the copies number per 1 μl of reaction.&lt;/p&gt; &lt;ul&gt; &lt;li&gt;Analysis&lt;/li&gt; &lt;/ul&gt; &lt;p&gt;Amplification results from ddPCR were analyzed both considering the number of positive replicates among the 3 replicates per sample and quantitatively using the number of copies per µL. Repeatability by sample between the PCR replicates was assessed with the R package rptR (Stoffel et al. 2017). The average number of copies per µL measured with ddPCR were related to site, depth and season using a General Linear Model (GLM). We used a Poisson distribution to model the average number of copies per µL among the 3 replicates for each sample. We added a dummy variable representing a putative reproduction event on a particular summer sampling day.&lt;/p&gt