The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Dietary Intake of Natural Sources of Docosahexaenoic Acid and Folate in Pregnant Women of Three European Cohorts

Background: Folic acid plays a fundamental role in cell division and differentiation. Docosahexaenoic acid (DHA) has been associated with infantile neurological and cognitive development. Thus, optimal intrauterine development and growth requires adequate supply of these nutrients during pregnancy. Methods: Healthy pregnant women, aged 18-41 years, were recruited in Granada (Spain; n = 62), Munich (Germany; n = 97) and Pecs (Hungary; n = 152). We estimated dietary DHA and folate intake in weeks 20 (w20) and 30 of gestation (w30) using a food frequency questionnaire with specific focus on the dietary sources of folate and DHA. Results: Both w20 and w30 Spanish participants had significantly higher daily DHA intakes (155 +/- 13 and 161 +/- 9 mg/1,000 kcal) than the German (119 +/- 9 and 124 +/- 12 mg/1,000 kcal; p = 0.002) and Hungarian participants (122 +/- 8 and 125 +/- 10 mg/1,000 kcal; p = 0.005). Hungarian women had higher folate intakes in w20 and w30 (149 +/- 5 and 147 +/- 6 mu g/1,000 kcal) than Spanish (112 +/- 2 and 110 +/- 2 mu g/1,000 kcal; p < 0.001) and German participants (126 +/- 4 and 120 +/- 6 mu g/1,000 kcal; p < 0.001), respectively. Conclusion: Dietary DHA and folate intake of pregnant women differs significantly across the three European cohorts. Only 7% of the participants reached the recommended folate intake during pregnancy, whereas nearly 90% reached the DHA recommended intake of 200 mg per day. Copyright (C) 2008 S. Karger AG, Base

Estudio faunístico del macizo de Quinto Real. II. Moluscos (Mollusca)

Se estudia en este trabajo la fauna de Moluscos de Quinto Real. Se han recolectado 516 ejemplares pertenecientes a 23 especies diferentes. Solo tres especies viven en ambientes acuáticos, las demás son te rrestres. Todas las especies terrestres viven en los bosques de hayasT En los habitats fuera del hayedo, que tienen una fuerte influencia antropógena, la fauna de moluscos es muy pobre

Approximate Prediction of Gas-Solid Conversion in Fluidized Bed Reactors

A simple method is proposed to evaluate the performance of fluidized bed reactors where an nth-order gas-solid reaction occurs. The method takes into account the fluid dynamics of the fluidized bed by a two-phase flow model and the rates of diffusion in the solid reactant particles (internal and external) by a simple particle model. Approximate analytical expressions are derived in terms of three effectiveness factors: interphasic, external and intraparticle. These account for the contribution of fluid-dynamic and diffusional resistances to the overall mass-transfer resistance. Gas conversion is expressed in terms of four dimensionless governing quantities and the reaction order, in this way facilitating computations. Limiting cases of the general solution are discussed by comparison with analytical solutions found in literature. The methodology can be applied to catalytic or non-catalytic systems under isothermal conditions, where one heterogeneous reaction is involved

Introduction: The nexus of multimodality, multimodal literacy, and English language teaching in research and practice in higher education settings

The aims of this Special Issue are to (1) advance the current state of research-based knowledge about how multimodal and multimedia resources can be leveraged to enhance multimodal communication practices in English language teaching in higher education, and (2) to provide a platform for original research-based practical applications that incorporate innovative multisemiotic resources and techniques, thereby offering new perspectives on the benefits of the multimodal approach when teaching English for both general and specific purposes at the university level. In the following section, we discuss the role of multimodal literacy in the context of enhancing language proficiency as the underlying objective of English language practitioners