17 research outputs found
Nitrogen Fixation Mutants of the Actinobacterium Frankia Casuarinae CcI3
Frankia is a representative genus of nitrogen-fixing (N2-fixing) actinobacteria; however, the molecular mechanisms underlying various phenomena such as the differentiation of a N2 fixation-specific structure (vesicle) and the regulation of N2 fixation (nif) genes, have yet to be elucidated in detail. In the present study, we screened hyphal fragments of Frankia casuarinae that were mutagenized by 1-methyl-3-nitro-1-nitrosoguanidine or gamma rays, and isolated 49 candidate N2 fixation mutants. Twelve of these mutants were selected for further study, and their abilities to grow in NH3-deficient (N-) liquid media and their rates of acetylene reduction activities were evaluated. Eleven mutant strains were confirmed to lack the ability to fix N2. Five mutant strains formed significantly reduced numbers of vesicles, while some failed to form large mature vesicles. These vesicle mutants also exhibited an aberrant hyphal morphology, suggesting a relationship between vesicle differentiation and hyphal branching. Ten mutants showed significant reductions in the expression of nifE, nifH, and nifV genes under N- conditions. The genome sequencing of eight mutants identified 20 to 400 mutations. Although mutant strains N3H4 and N6F4 shared a large number of mutations (108), most were unique to each strain. Mutant strain N7C9 had 3 mutations in the nifD and nifH genes that may result in the inability to fix N2. The other mutant strains did not have any mutations in any known N2 fixation-related genes, indicating that they are novel N2 fixation mutants
Hemoglobin LjGlb1-1 is involved in nodulation and regulated the level of nitric oxide in the Lotus japonicus-Mesorhizobium loti symbiosis
Leghemoglobins transport and deliver O2 to the symbiosomes inside legume nodules and are essential for nitrogen fixation. However, the roles of other hemoglobins (Hbs) in the rhizobia–legume symbiosis are unclear. Several Lotus japonicus mutants affecting LjGlb1-1, a non-symbiotic class 1 Hb, have been used to study the function of this protein in symbiosis. Two TILLING alleles with single amino acid substitutions (A102V and E127K) and a LORE1 null allele with a retrotransposon insertion in the 5′-untranslated region (96642) were selected for phenotyping nodulation. Plants of all three mutant lines showed a decrease in long infection threads and nodules, and an increase in incipient infection threads. About 4h after inoculation, the roots of mutant plants exhibited a greater transient accumulation of nitric oxide (NO) than did the wild-type roots; nevertheless, in vitro NO dioxygenase activities of the wild-type, A102V, and E127K proteins were similar, suggesting that the mutated proteins are not fully functional in vivo. The expression of LjGlb1-1, but not of the other class 1 Hb of L. japonicus (LjGlb1-2), was affected during infection of wild-type roots, further supporting a specific role for LjGlb1-1. In conclusion, the LjGlb1-1 mutants reveal that this protein is required during rhizobial infection and regulates NO levels
Different dynamics of genome content shuffling among host-specificity groups of the symbiotic actinobacterium Frankia
The Determinants of the Actinorhizal Symbiosis
International audienceThe actinorhizal symbiosis is a major contributor to the global nitrogen budget, playing a dominant role in ecological successions following disturbances. The mechanisms involved are still poorly known but there emerges the vision that on the plant side, the kinases that transmit the symbiotic signal are conserved with those involved in the transmission of the Rhizobium Nod signal in legumes. However, on the microbial side, complementation with Frankia DNA of Rhizobium nod mutants failed to permit identification of symbiotic genes. Furthermore, analysis of three Frankia genomes failed to permit identification of canonical nod genes and revealed symbiosis-associated genes such as nif, hup, suf and shc to be spread around the genomes. The present review explores some recently published approaches aimed at identifying bacterial symbiotic determinants
Cis-acting Elements and DNA-Binding Proteins Involved in CO(2)-Responsive Transcriptional Activation of Cah1 Encoding a Periplasmic Carbonic Anhydrase in Chlamydomonas reinhardtii
Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO(2) conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between –293 and –231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO(2) conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5′-upstream region from –651 to –231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO(2) conditions. These EEC-binding proteins were present even in cells grown under high-CO(2) conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5′-upstream region of Cah1 is discussed
Characterization of Nitric Oxide-Inducing Lipid A Derived from Mesorhizobium loti Lipopolysaccharide
Global Analysis of Circadian Expression in the Cyanobacterium Synechocystis sp. Strain PCC 6803
Cyanobacteria are the only bacterial species found to have a circadian clock. We used DNA microarrays to examine circadian expression patterns in the cyanobacterium Synechocystis sp. strain PCC 6803. Our analysis identified 54 (2%) and 237 (9%) genes that exhibited circadian rhythms under stringent and relaxed filtering conditions, respectively. The expression of most cycling genes peaked around the time of transition from subjective day to night, suggesting that the main role of the circadian clock in Synechocystis is to adjust the physiological state of the cell to the upcoming night environment. There were several chromosomal regions where neighboring genes were expressed with similar circadian patterns. The physiological functions of the cycling genes were diverse and included a wide variety of metabolic pathways, membrane transport, and signal transduction. Genes involved in respiration and poly(3-hydroxyalkanoate) synthesis showed coordinated circadian expression, suggesting that the regulation is important for the supply of energy and carbon source in the night. Genes involved in transcription and translation also followed circadian cycling patterns. These genes may be important for output of the rhythmic information generated by the circadian clock. Our findings provided critical insights into the importance of the circadian clock on cellular physiology and the mechanism of clock-controlled gene regulation