High throughput molecular confirmation of β-thalassemia mutations using novel TaqMan probes

β-Thalassemia is a public health problem where 4.5% of Malaysians are β-thalassemia carriers. The genetic disorder is caused by defects in the β-globin gene complex which lead to reduced or complete absence of β-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common β-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 “blinded” DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of β-thalassemia mutations in the Malaysian population

Molecular characterisation of β-globin gene mutations in Penang and Kedah, Malaysia

Introduction: Beta-thalassaemia is an autosomal recessive disorder and it is a public health problem in the Malaysian Malays and Chinese. This disorder mainly results from point mutations, small insertion or deletions in the β-globin gene complex. Beta-thalassaemia major patients require life-long monthly blood transfusions and iron-chelation therapies to sustain their lives. Mutation characterisation is necessary for affected couples at risk of having a β-thalassaemia major child. Objective: 1. To develop the TaqMan genotyping platform as a time- and cost-effective approach for characterisation of β-globin gene mutations. 2. To characterise the mutations using the developed assays in transfusion-dependent patients in Penang and Kedah. Methods: Ten sets of primers and TaqMan probes were designed to identify the common mutations in Malaysian Malays and Chinese: −28 (A→G), CD17 (A→T), CD19 (A→G), HbE (G→A), IVS1-1 (G→T), IVS1-5 (G→C), CD 41/42 (-CTTT), CD71/72 (+A), IVS2-654 (C→T) and Poly A (AATAAAHAATAGA). Another 7 sets of TaqMan genotyping assays were designed to identify the rare mutations in Malays and Chinese: −29 (A→G), Cap (+1) (A→C), CD8/9 (+G), CD16 (-C), CD27/28 (+C), IVS1-1 (G→A) and CD43 (G→T). The developed assays were used to screen 54 and 62 transfusion-dependent patients in Penang and Kedah respectively. Results & Discussion: The developed assays detected 92.9% of mutations in the β-thalassaemia major patients. The remaining mutations were detected by ARMS, gap-PCR and DNA sequencing. The most common mutation in β-thalassaemia major patients in Penang is CD41/42 with a frequency of 20.9%. The most common mutation in β-thalassaemia major patients in Kedah is HbE with a frequency of 30.8%. Conclusion: The simplicity and reproducibility of the TaqMan genotyping assays enable rapid and cost-effective analysis of the β-globin gene mutations in Malaysia

Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia

DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-Thalassaemia

Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations