In vitro activation and enzyme kinetic analysis of recombinant midgut serine proteases from the Dengue vector mosquito Aedes aegypti

<p>Abstract</p> <p>Background</p> <p>The major Dengue virus vector <it>Aedes aegypti </it>requires nutrients obtained from blood meal proteins to complete the gonotrophic cycle. Although bioinformatic analyses of <it>Ae. aegypti </it>midgut serine proteases have provided evolutionary insights, very little is known about the biochemical activity of these digestive enzymes.</p> <p>Results</p> <p>We used peptide specific antibodies to show that midgut serine proteases are expressed as zymogen precursors, which are cleaved to the mature form after blood feeding. Since midgut protein levels are insufficient to purify active proteases directly from blood fed mosquitoes, we engineered recombinant proteins encoding a heterologous enterokinase cleavage site to permit generation of the bona fide mature form of four midgut serine proteases (AaET, AaLT, AaSPVI, AaSPVII) for enzyme kinetic analysis. Cleavage of the chromogenic trypsin substrate BApNA showed that AaET has a catalytic efficiency (k_cat/K_M) that is ~30 times higher than bovine trypsin, and ~2-3 times higher than AaSPVI and AaSPVII, however, AaLT does not cleave BApNA. To measure the enzyme activities of the mosquito midgut proteases using natural substrates, we developed a quantitative cleavage assay based on cleavage of albumin and hemoglobin proteins. These studies revealed that the recombinant AaLT enzyme was indeed catalytically active, and cleaved albumin and hemoglobin with equivalent efficiency to that of AaET, AaSPVI, and AaSPVII. Structural modeling of the AaLT and AaSPVI mature forms indicated that AaLT is most similar to serine collagenases, whereas AaSPVI appears to be a classic trypsin.</p> <p>Conclusions</p> <p>These data show that <it>in vitro </it>activation of recombinant serine proteases containing a heterologous enterokinase cleavage site can be used to investigate enzyme kinetics and substrate cleavage properties of biologically important mosquito proteases.</p

Alpha-COPI Coatomer Protein Is Required for Rough Endoplasmic Reticulum Whorl Formation in Mosquito Midgut Epithelial Cells

One of the early events in midgut epithelial cells of Aedes aegypti mosquitoes is the dynamic reorganization of rough endoplasmic reticulum (RER) whorl structures coincident with the onset of blood meal digestion. Based on our previous studies showing that feeding on an amino acid meal induces TOR signaling in Ae. aegypti, we used proteomics and RNAi to functionally identify midgut epithelial cell proteins that contribute to RER whorl formation.Adult female Ae. aegypti mosquitoes were maintained on sugar alone (unfed), or fed an amino acid meal, and then midgut epithelial cells were analyzed by electron microscopy and protein biochemistry. The size and number of RER whorls in midgut epithelial cells were found to decrease significantly after feeding, and several KDEL-containing proteins were shown to have altered expression levels. LC-MS/MS mass spectrometry was used to analyze midgut microsomal proteins isolated from unfed and amino acid fed mosquitoes, and of the 127 proteins identified, 8 were chosen as candidate whorl forming proteins. Three candidate proteins were COPI coatomer subunits (alpha, beta, beta'), all of which appeared to be present at higher levels in microsomal fractions from unfed mosquitoes. Using RNAi to knockdown alpha-COPI expression, electron microscopy revealed that both the size and number of RER whorls were dramatically reduced in unfed mosquitoes, and moreover, that extended regions of swollen RER were prevalent in fed mosquitoes. Lastly, while a deficiency in alpha-COPI had no effect on early trypsin protein synthesis or secretion 3 hr post blood meal (PBM), expression of late phase proteases at 24 hr PBM was completely blocked.alpha-COPI was found to be required for the formation of RER whorls in midgut epithelial cells of unfed Aa. aegypti mosquitoes, as well as for the expression of late phase midgut proteases

Comparative analysis of the vitellogenin genes of the Culicidae

A comparative sequence analysis of mosquito vitellogenin genes was done to gain a better understanding of the evolution of vitellogenin genes in mosquitoes. Genomic clones of vitellogenin genes were isolated from Aedes aegypti , Ae. atropalpus, Culex quinquefasciatus , Toxorhynchites amboinensis, and Anopheles albimanus. Vitellogenin genes were also cloned using degenerate PCR primers from 34 species of mosquitoes representing genera (Aedes, Anopheles, Armigeres, Coquillettidia, Culex, Culiseta, Deinocerites, Psorophora, Mansonia, Mimomyia, Toxorhynchites, and Wyeomyia). Analysis of mosquito vitellogenin gene sequences suggests that a majority of nonsynonymous amino acid substitutions were due to conserved and moderately conserved changes. The vitellogenin genes of the three anautogenous mosquito species had very high synonymous codon usage biases. On the other hand, the vitellogenin genes of autogenous mosquitoes exhibited low synonymous codon usage bias. An unusual pattern of synonymous codon usage was observed in the first 15 amino acid residues encoding the signal peptide in the mosquito vitellogenin genes, where a significantly high number of rarely used synonymous codons have accumulated. A phylogenetic footprinting analysis detected several evolutionarily conserved sequence elements in the 5' regulatory regions of some of the mosquito vitellogenin genes. Mosquito phylogenetic trees reconstructed from maximum parsimony, maximum likelihood, and distance methods based on vitellogenin gene sequences are highly supported and robust, and vitellogenin gene sequences can be utilized to infer the phylogenetic history of mosquitoes, and perhaps other animals

Urea synthesis and excretion in Aedes aegypti mosquitoes are regulated by a unique cross-talk mechanism.

Aedes aegypti mosquitoes do not have a typical functional urea cycle for ammonia disposal such as the one present in most terrestrial vertebrates. However, they can synthesize urea by two different pathways, argininolysis and uricolysis. We investigated how formation of urea by these two pathways is regulated in females of A. aegypti. The expression of arginase (AR) and urate oxidase (UO), either separately or simultaneously (ARUO) was silenced by RNAi. The amounts of several nitrogen compounds were quantified in excreta using mass spectrometry. Injection of mosquitoes with either dsRNA-AR or dsRNA-UO significantly decreased the expressions of AR or UO in the fat body (FB) and Malpighian tubules (MT). Surprisingly, the expression level of AR was increased when UO was silenced and vice versa, suggesting a cross-talk regulation between pathways. In agreement with these data, the amount of urea measured 48 h after blood feeding remained unchanged in those mosquitoes injected with dsRNA-AR or dsRNA-UO. However, allantoin significantly increased in the excreta of dsRNA-AR-injected females. The knockdown of ARUO mainly led to a decrease in urea and allantoin excretion, and an increase in arginine excretion. In addition, dsRNA-AR-injected mosquitoes treated with a specific nitric oxide synthase inhibitor showed an increase of UO expression in FB and MT and a significant increase in the excretion of nitrogen compounds. Interestingly, both a temporary delay in the digestion of a blood meal and a significant reduction in the expression of several genes involved in ammonia metabolism were observed in dsRNA-AR, UO or ARUO-injected females. These results reveal that urea synthesis and excretion in A. aegypti are tightly regulated by a unique cross-talk signaling mechanism. This process allows blood-fed mosquitoes to regulate the synthesis and/or excretion of nitrogen waste products, and avoid toxic effects that could result from a lethal concentration of ammonia in their tissues

Effect of arginase (AR), urate oxidase (UO) and ARUO knockdown on gene expression.

<p><i>A. aegypti</i> females were injected with dsRNA-firefly luciferase (dsRNA-FL), dsRNA-AR, dsRNA-UO or dsRNA-ARUO and then fed a blood meal. A-D. Relative abundance of AR and UO mRNA in tissues of dsRNA-injected females at 24 h after blood feeding. E–H. Relative abundance of AR and UO mRNA in tissues of dsRNA-injected females at 48 h after blood feeding. Data are presented as the mean ± SEM of five independent samples. *<i>p</i><0.05, **<i>p</i><0.01, ***<i>p</i><0.001 (when compared to dsRNA-FL by ANOVA).</p

Effect of silencing of arginase (AR), urate oxidase (UO) or both (ARUO) on the expression of several genes.

<p>Relative abundance of glutamine synthetase (GS1 and GS2), glutamate synthase (GltS), glutamate dehydrogenase (GDH), alanine aminotransferase (ALAT1 and ALAT2), pyrroline-5-carboxylate synthase (P5CS), pyrroline-5-carboxylate reductase (P5CR1 and P5CR3), xanthine dehydrogenase (XDH1 and XDH2) mRNA levels in the fat body of dsRNA-injected females at 48 h after feeding a blood meal. Data are presented as the mean ± SEM of five to ten independent samples. ***<i>p</i><0.001 (when compared to dsRNA-firefly luciferase (dsRNA-FL) by ANOVA).</p

Effect of arginase (AR) knockdown and L-NAME, a nitric oxide synthase inhibitor, on urate oxidase (UO) expression.

<p><i>A. aegypti</i> females were injected with dsRNA-firefly luciferase (dsRNA-FL) or dsRNA-AR and then fed with a blood meal in the presence or absence of L-NAME (L). A–B. Relative abundance of UO mRNA in tissues of injected mosquitoes at 24 h after blood feeding. C–D. Relative abundance of UO mRNA in tissues of injected mosquitoes at 48 h after blood feeding. Data are presented as the mean ± SEM of five independent samples. *<i>p</i><0.05, ***<i>p</i><0.001 (when compared to dsRNA-FL or dsRNA-AR by unpaired Student’s <i>t</i>-test).</p

Primers for qRT-PCR and dsRNA synthesis.

*<p>T7 bacteriophage promoter sequence (5' TAATACGACTCACTATAGGGAGA 3') was added in 5' of each primer.</p

Integrated schematic representation of ammonia metabolism and proposed cross-talk mechanism for metabolic regulation of urea.

<p>Fixation, assimilation and excretion pathways of ammonia metabolism were previously studied in <i>A. aegypti</i> (11–13). The proposed metabolic regulation of urea occurs mainly via a cross-talk signaling mechanism. It affects the metabolism of other nitrogen compounds, as discussed in the text. Colored arrows indicate a cross-talk between UO (red), AR (green) and NOS (blue). Abbreviations: Glutamine synthetase (GS), glutamate synthase (GltS), glutamate dehydrogenase (GDH), alanine aminotransferase (ALAT), pyrrolidine-5-carboxylate synthase (P5CS), pyrrolidine-5-carboxylate reductase (P5CR), xanthine dehydrogenase (XDH), urate oxidase (UO), allantoinase (ALLN), allantoicase (ALLC), arginase (AR) and nitric oxide synthase (NOS).</p