On Damage Identification in Planar Frames of Arbitrary Size

Framed structures are deeply studied in civil engineering since they provide a numerical model for the analysis of the static and dynamic response of multi-storey buildings. In order to evaluate the vibrational properties of these structures, an eigen-problem, which involves the stiffness and mass matrices of the frame, must be solved. Both matrices can be assembled by means of standard methods, which take into account the numbers of degrees of freedom of the frame. The occurrence of concentrated damage in some vulnerable sections modifies the degrees of freedom and therefore both the stiffness and mass matrices. Very often, the critical sections are located in the joints between the structural elements of the frame where the bending moment reaches its maximum value. Assuming that the joints are rigid in the undamaged configuration of the frame, it is possible to take into account their loss of stiffness due to the presence of eventual damage by means of hinges with rotational springs of variable rigidity. In this paper, an original algorithm that allows us to evaluate the stiffness and mass matrices and therefore the natural frequencies of vibration of undamaged and damaged planar frames with an arbitrary number of beams and columns is presented. The proposed algorithm for the stiffness and mass matrices determination requires a few input data which can be provided in a text file and therefore allows us to speed up the procedure with respect to the application of an FEM approach which requires the construction of single models for each considered frame. The results obtained by means of the proposed algorithm have been validated through a comparison with those provided by an FEM model implemented in SAP2000. The natural frequencies obtained by means of the proposed approach are used for the solution of two different inverse problems, which concern the identification of, respectively, the mechanical characteristics of the constitutive material and the location and intensity of the damage. Both the proposed identification procedures deal with optimization algorithms that are based on opportune fitness functions. Applications to frames of different size confirm the validity of the presented identification algorithms. Furthermore, an iterative procedure, able to reduce the required computational burden related to the identification of the location and intensity of damage, is presented and applied in a parametric study concerning frames with increasing size

Tone-in-noise detection deficits in elderly patients with clinically normal hearing

One of the most common complaints among the elderly is the inability to understand speech in noisy environments. In many cases, these deficits are due to age-related hearing loss; however, some of the elderly that have difficulty hearing in noise have clinically normal pure-tone thresholds. While speech in noise testing is informative, it fails to identify specific frequencies responsible for the speech processing deficit. Auditory neuropathy patients and animal models of hidden hearing loss suggest that tone-in-noise thresholds may provide frequency specific information for those patients who express difficulty, but have normal thresholds in quiet. Therefore, we aimed to determine if tone-in-noise thresholds could be a useful measure in detecting age-related hearing deficits, despite having normal audiometric thresholds

Denervation does not induce muscle atrophy through oxidative stress

Denervation leads to the activation of the catabolic pathways, such as the ubiquitin-proteasome and autophagy, resulting in skeletal muscle atrophy and weakness. Furthermore, denervation induces oxidative stress in skeletal muscle, which is thought to contribute to the induction of skeletal muscle atrophy. Several muscle diseases are characterized by denervation, but the molecular pathways contributing to muscle atrophy have been only partially described. Our study delineates the kinetics of activation of oxidative stress response in skeletal muscle following denervation. Despite the denervation-dependent induction of oxidative stress in skeletal muscle, treatments with anti-oxidant drugs do not prevent the reduction of muscle mass. Our results indicate that, although oxidative stress may contribute to the activation of the response to denervation, it is not responsible by itself of oxidative damage or neurogenic muscle atrophy

Exploring the Gut Microbiome Alteration of the European Hare (Lepus europaeus) after Short-Term Diet Modifications

This study aimed to characterise the gut microbiome composition of European hares (Lepus europaeus) and its potential changes after a short-term diet modification. The high sensitivity of European hare to habitat changes makes this species a good model to analyse possible alterations in gut microbiome after the introduction of additional nourishment into the diet. In total, 20 pairs were chosen for the experiments; 10 pairs formed the control group and were fed with standard fodder. The other 10 pairs represented the experimental group, whose diet was integrated with apples and carrots. The DNA from fresh faecal pellets collected after 4 days from the start of the experiment was extracted and the V3-V4 hypervariable regions were amplified and sequenced using the Illumina MiSeq® platform. The obtained amplicon sequence variants were classified into 735 bacterial genera belonging to 285 families and 36 phyla. The control and the experimental groups appeared to have a homogenous dispersion for the two taxonomic levels analysed with the most abundant phyla represented by Bacteroidetes and Firmicutes. No difference between control and experimental samples was detected, suggesting that the short-term variation in food availability did not alter the hares’ gut microbiome. Further research is needed to estimate significant time threshold

Correction: Rheometry-on-a-chip: measuring the relaxation time of a viscoelastic liquid through particle migration in microchannel flows

n/

Pulsating Variable Stars in the Coma Berenices dwarf spheroidal galaxy

We present B, V, I time-series photometry of the Coma Berenices dwarf spheroidal galaxy, a faint Milky Way satellite, recently discovered by the Sloan Digital Sky Survey. We have obtained V, B-V and V, V-I color-magnitude diagrams that reach V~23.0-23.2 mag showing the galaxy turnoff at V~21.7 mag, and have performed the first study of the variable star population of this new Milky Way companion. Two RR Lyrae stars (a fundamental-mode -RRab- and a first overtone -RRc- pulsator) and a short period variable with period P=0.12468 days were identified in the galaxy. The RRab star has a rather long period of P_ab=0.66971 days and is about 0.2 mag brighter than the RRc variable and other non-variable stars on the galaxy horizontal branch. In the period-amplitude diagram the RRab variable falls closer to the loci of Oosterhoff type-II systems and evolved fundamental-mode RR Lyrae stars in the Galactic globular cluster M3. The average apparent magnitude of the galaxy horizontal branch, =18.64+-0.04 mag, leads to a distance modulus for the Coma dSph mu_0=18.13+-0.08 mag, corresponding to a distance d=42^{+2}_{-1} kpc, by adopting a reddening E(B-V) = 0.045 +- 0.015 mag and a metallicity [Fe/H]=-2.53 +- 0.05 dex.Comment: 14 pages, 3 figures, Accepted for publication in ApJ

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations

Neuropsychological functions and audiological findings in elderly cochlear implant users: the role of attention in postoperative performance

Objectives: The present study aimed to investigate in a group of elderly CI users working memory and attention, conventionally considered as predictors of better CI performance and to try to disentangle the effects of these cognitive domains on speech perception, finding potential markers of cognitive decline related to audiometric findings. Methods Thirty postlingually deafened CI users aged >60 underwent an audiological evaluation followed by a cognitive assessment of attention and verbal working memory. A correlation analysis was performed to evaluate the associations between cognitive variables while a simple regression investigated the relationships between cognitive and audiological variables. Comparative analysis was performed to compare variables on the basis of subjects’ attention performance. Results: Attention was found to play a significant role in sound field and speech perception. Univariate analysis found a significant difference between poor and high attention performers, while regression analysis showed that attention significantly predicted recognition of words presented at Signal/Noise +10. Further, the high attention performers showed significantly higher scores than low attentional performers for all working memory tasks. Conclusion: Overall findings confirmed that a better cognitive performance may positively contribute to better speech perception outcomes, especially in complex listening situations. WM may play a crucial role in storage and processing of auditory-verbal stimuli and a robust attention may lead to better performance for speech perception in noise. Implementation of cognitive training in auditory rehabilitation of CI users should be investigated in order to improve cognitive and audiological performance in elderly CI users