The Characteristics of Ledok Which is Added with Seaweed

Ledok is a traditional food like porridge originally from Nusa Penida, Klungkung Regency, Bali Province, Indonesia. Ledok main ingredient is white corn and cassava tubers and coupled with vegetables and seasoning obtained locally. Ledok is potentially developed into functional food because it contains bioactive components such as dietary fiber, minerals and antioxidants. The purpose of the research was to determine the type of seaweed that produces ledok with the best characteristics in terms of sensory aspects, nutrient content, minerals, dietary fiber and antioxidant activity. The experiment used a randomized block design with the treatments of the types of seaweed, i.e.: R0 (without seaweed addition), R1 (added with E.cottoni seaweed, R2 (added with E.spinosum seaweed) and R3 (added with Gracilaria sp.seaweed). The treatments were repeated six times. Addition of seaweed was as much as 10 percent of the total weight of the ledok materials except water. The characteristics of ledok observed were the sensory properties (color, aroma, texture, flavor and overall acceptability), the content of nutrients (water, ash, fat, protein and carbohydrates), antioxidant capacity, IC-50, dietary fiber and minerals. The results showed that the types of seaweed effect on aroma, protein content, antioxidant capacity, Ca and Mn minerals. The addition of Gracilaria seaweed produces ledok with the best characteristics of acceptability of moderately favored sensory, 0.11% of fat content, 2.54% of protein, 15.28% of carbohydrate, antioxidant capacity of 66.24 ppm GAEAC, IC-50 of 155.32 mg/ml, total dietary fiber of 18,40% db (dry basis), Ca of 2,620.72 ppm and Mn of 17.18 ppm. Keywords: ledok, seaweed, sensory properties, antioxidant capacity, dietary fiber

OPTIMIZATION OF EXOPOLYSACCHARIDE PRODUCTION BY Lactobacillus casei AL.15

Exopolysaccharide (EPS) is one of the polysaccharides produced from microorganisms. This polysaccharide is usually produced by lactic acid bacteria and it is widely used for food products and pharmaceutical products. EPS are also very useful for stabilizers, emulsifiers, gelling agents, and have a good ability to bind liquids (water). This study aims to determine the optimization point of EPS growth, based on temperature, time, and the amount of glucose used in selective growth media of Lactobacillus casei (L. casei) AL.15, namely de Mann Rogosa Shape Broth (MRSB) media, using Response Surface Method (RSM) design to obtain optimum conditions that are more appropriate to produce EPS. Optimization of EPS production occurred at level -1; -1; 0, temperature 42 °C, incubation time 48 hours, and the addition of 10% glucose. L. casei AL.15 has a good ability to produce EPS at the temperature, time, and amount of glucose obtained. The result obtained under these conditions is 606.03 mg EPS/litre. This method can be used to produce large amounts of EPS and then these characteristics were analyzed

Impact of Medical Waste Socialization on Medical Waste Management in Health Services Facilities

It is important to disseminate information about medical waste in health care facilities to provide knowledge and skills for paramedics, patients and the general public so that medical waste generated from each service facility can be managed properly and in accordance with applicable laws. When viewed from the amount of medical waste originating from health facilities, it is estimated that it will increase over time. The reason is that the number of hospitals, health centers, treatment centers, medical laboratories and health clinics is increasing. Thus, the purpose of writing this article is to determine the impact of socialization of medical waste on the handling of medical waste in health care facilities. The method used is Literature Review in a way that is used to collect data or sources related to a particular topic that can be obtained from various sources of English-language international journals sourced from the PubMeb database, Google Schola, Semantic Scholar, Emerald Insight. Search results with keywords Socialization, Medical Waste, Handling, Health Service Facilities found 50 journals that match these keywords. A total of 37 journals from journals found according to the search keywords were then screened, 10 journals were excluded because full text articles were not available. Journals that meet the inclusion range of 5 full text journals are reviewed. So the conclusion is that the dissemination of information in health care facilities is very important in providing knowledge and skills for medical professionals, patients and the general public in managing medical waste

Characterization of Exopolysaccharide Produced by Lactobacillus casei AL15 Isolated from Sap of Arenga pinnata

Exopolysaccharide (EPS) is a polymer of a reducing sugar which has a high molecular weight. This polysaccharide is usually produced by lactic acid bacteria, and has a very large usability for food products and pharmaceutical products. Lactobacillus casei AL15 is a type of lactic acid bacteria isolated from sap of Arenga pinnata and has a great potential to produce EPS. Productivity in producing EPS of L. casei AL15 in MRS broth medium is about 14.1 mg/L. Furthermore, component of carbon was a highest composition of the EPS tested by SEM. The image of SEM showed that the shape of EPS were round to ellipse shape with smooth surface texture and white yellowish color. The spectrum of FTIR produced the wavenumber in the range of 3338 cm-1 – 1056 cm-1. The spectrum indicated the presence of O-H in 3338.78 cm-1, C-H in 2962.66 cm-1, C=O in 1649,14 cm-1 and C-O-C in 1056.99 cm-1. Those bonds indicated that EPS produced by L. casei AL15 was heteropolysaccharide (HePS), since the FTIR spectrum had a same spectrum with sucrose and glucose. This result was also supported by HPLC analysis, which showed that the hydrolyzed EPS was composed by sucrose and glucose. Overall results showed that L. casei EPS AL15 was HePS. Keywords: characterization, exopolysaccharide, Lactobacillus casei AL15, Arenga pinnata

Microflora and Selected Metabolites of Potato Pulp Fermented with an Indonesian Starter Ragi Tapé

When potato pulp was mixed with Indonesian starter ragi tapé and incubated, both lactic acid and ethanol were gradually formed and attained certain concentrations during 2 days of fermentation. Viable counts of fungi in fresh weight matter, yeasts and lactic acid bacteria after fermentation were 105, 107 and 105 CFU/g, respectively. Denaturing gradient gel electrophoresis of the PCR-amplified internal transcribed spacer of 18S–28S rRNA genes detected Amylomyces rouxii-Rhizopus oryzae, Mucor indicus, Candida tropicalis and Saccharomycopsis fibuligera and revealed that Amylomyces rouxii-Rhizopus oryzae dominated throughout the fermentation period. Amylomyces rouxii cannot be discriminated from the lactic acid-accumulating group of Rhizopus oryzae because the amplified sequences of these fungi were shown to be identical. Morphological characteristics were then studied for Rhizopus-like fungi isolated from fermented potato pulp. Those strains that had produced an enormous number of chlamydospores in the aerial and substrate mycelium were identified as Amylomyces rouxii. The microflora of fermented potato pulp was similar to that made from glutinous rice, namely tapé ketan

Pengembangan Budaya Mutu di Perguruan Tinggi

Budaya mutu sejatinya merupakan sistem nilai organisasi yang menciptakan lingkungan yang kondusif untuk keberlangsungan perbaikan mutu yang berkesinambungan. Budaya mutu terdiri dari nilai-nilai, tradisi, prosedur yang mengikuti siklus PPEPP yang telah terjadi secara terus menerus berkesinambungan menuju continues quality improvement dan harapan tentang promosi mutu. Dalam upaya mengembangkan Budaya Mutu di Universitas Warmadewa, semua pihak yang berkepentingan (internal stakeholders) di Universitas Warmadewa harus berpikir, bersikap, dan bertindak berdasarkan Standar Pendidikan Tinggi (Standar Dikti) (SN-Dikti) dan standar tambahan yang ditetapkan oleh Universitas Warmadewa. Untuk menjadi universitas yang bermutu, tentunya praktik baik budaya mutu harus dijalankan di setiap unit pelaksana di lingkungan Universitas Warmadewa. Salah satu upaya atau bukti dijalankannya praktik baik budaya mutu adalah diterbitkannya buku tentang praktik baik berupa book chapters. Book Chapters ini disusun dengan mengundang para penulis dari kalangan dosen hingga pejabat stuktural Warmadewa untuk mengekspresikan praktik baik yang dialaminya terkait penjaminan mutu. Terbitnya Book Chapters ini tentunya juga sebagai penanda bahwa praktik baik budaya mutu sudah berjalan di Warmadewa

Pemikiran kritis guru besar Universitas Udayana bidang agrokomplek

xi, 276 p. ; 21 cm

Analisis Sekuen Probe Gena Shiga Like Toxin-2 dari Isolat Lokal Escherichia coli O157:H7 (PROBE SEQUANCE ANALYSIS OF SHIGA LIKE TOXIN-2 GEN FROM ESCHERICHIA COLI O157:H7 LOCAL ISOLATES)

A Shiga-like toxin producing Escherichia coli O157:H7 was detected in faecal samples of cattle, andhuman as well as in beef. The performance of agent indicated that it has been identified as harmful andoften life-threatening zoonotic agent. It is therefore important to analysed the genetic characteristic ofShiga toxin Escherichia coli (STEC) and to develop a diagnostic probe in order  to optimalized of diagnostictest  for the agent. The  study was started by amplifiying  stx2 gene, purifying of PCR product, sequencingof stx2 gene, analyzing  of phylogenetic tree, and finally  by analyzing   of  diagnostic  probe candidate.Homology study showed that the genetic sequence of the local isolate of  E. coli O157:H7 i.e SM25(1)isolated from cattle feces has  a genetic and fuctional similarity with  the control isolate i.e E. coli O157:H7ATCC 43894 originated from human.  Further study showed that a probe with  foreward primer  sequanceof 5’-AATTTATATGTGGCCGGGTTC-‘3 which were respectively designed as a PFS and PRS 176 bp product.Appeared to be potential candidate of diagnostic probe for the agent

Aplikasi Kandidat Pemindai untuk Diagnosis Gen Shiga like toxin-2 dari Escherichia coli O157:H7 (PROBE APLICATION TO DIAGNOSTIC PROGRAME OF SHIGA LIKE TOXIN-2 (STX2) GEN FROM ESCHERICHIA COLI O157:H7)

A Shiga-like toxin producing Escherichia coli O157:H7 has been detected in cattle fecal sample, atbeef, and human as well as in beef and indicating that the agent is a harmful zoonosis bacteria. Geneticanalysis of Shiga toxin Escherichia coli (STEC) gene is important for development of probe to improve thediagnosis method for the agent. The study consisted of degrading and synthezing of PS2 probe withnucleotide sequence, 5’TTACACATATATCAGTGCCCGGTGTGA-CAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAACGTGTCGCAGCGCTGGAA-CGTTCCGGAATGCAAATCAGTCGTCA‘3, analyzing of labeled probe, extracting of genomic DNA, hybridizing dot-blot DNA-DNA, and finallydetecting of hybridization signal. The results show that PS2 probe can be used to detect Shiga like toxingene (stx2 gene) from E. coli O157:H7. The Probe has labeling efficiency up to 10 pg/?l. PS2 probe with 25ng/ml concentration has a capability to detect it’s complemantary in 10 ng/?l DNA samples concentration

Karakterisasi Lactobacillus spp. yang Diisolasi dari Susu Kambing Etawa untuk Pengembangan Probiotik (CHARACTERIZATION OF LACTOBACILLUS SPP., ISOLATED FROM MILK OF ETAWA GOATS FOR LOCAL PROBIOTIC DEVELOPMENT)

The objective of this research was to characterize Lactobacillus spp., isolated from milk of Etawagoats for local probiotic development. Total of 23 isolates Lactobacillus spp. were tested for resistance tolow pH conditions, high levels of natrium deoxy cholate, and modified gastric juice conditions. Besidesthat, those isolates were also tested to convert cholic acid (CA) into deoxycholic acid (DCA). Isolate thatshowed the most potential properties for local probiotic development was identified by 16S rDNA analysisusing following amplification of this sequence with primers of 27F and 520R). The results showed that 12isolates were found to be resistant to low pH conditions and to high level of NaDC (0.6 mM). Three of them(Lactobacillus spp. GMA46, Lactobacillus spp. GMA47 and Lactobacillus spp. GMA50) did not convertcholic acid into deoxy cholic acid, indicating that they are safe for human use. Lactobacillus spp. GMA46showed better performance in the gastric juice (a model of gastic and intestinal juice containing pepsin andpancreatin enzymes at pH 2, 3 and 4) simulation test. This GMA46 isolate was identified as L. caseiATCC 334 and L. paracasei subsp. tolerans strain NBRC 15906 with 100% similarity, in term of its 16srDNA nucleotide sequence. The results of this research indicate that Lactobacillus sp. GMA46 is anIndonesian potential probiotic strain, isolated from milk of etawa goat