Experimentelle Kaninchensyphilis und das Reticuloendothelialsystem

Bei experimenteller Kaninchensyphilis fuhrte der Verfasser seine Versuche aus, berucksichtigt auf die klinischen Befunde und die Wassermannsche Reaktion des mit Sp. pallida geimpften Kaninchens bei der Splenektomie, bei der Blockierung des Reticuloendothelialsystemes und bei der Einspritzung des Milzextractes. Die Resultate sind die folgenden: 1. Nachdem Spirochaeta pallida dem Kaninchen in den Hoden geimpft wurde, wurde die Blockierung mit Tusche ausgefuhrt. Im Verlaufe der Infektion zeigten sich lokale Befunde und Wassermannsche Reaktion die in jeder Hinsicht denen der Kontrollen glichen. 2. Beim Kaninchen, welches gleichzeizig entmilzt und mit Sp. pallida geimpft wurde, trat der Lokalaffekt etwas fruhzeizig auf und die Wassermannsche Reaktion war kurzdauernd positiv. 3. Falls die Impfung nach der Entmilzung ausgefuhrt war, stimmten die Resultate fast mit den obigen ein. 4. Wenn die Versuchstiere erst geimpft und dann entmilzt wurden, so wurde eine bemerkenswerte oedematose Anschwellung des Hodensacks und ein Kurzdauernder positive Ausfall der Wa. R. beobachtet. 5. Wenn die Entmilzung, Impfung und Blockierung gleichzeizig ausgefuhrt wurden, so zeigten sich die lokalen sowie metastatischen Befunde bei Versuchstieren wie ohne Entmilzung, doch war die positive Phase der Wa. R. bedeutend verkurzt und dabei ihre Grad niederwertig. 6. Erst geimpft und dann mit Milzextract wiederhohlt gespritzt, so verliefen die lokalen sowie metastatischen Befunde leichter und die Wa. R. brach fruhzeizig positiv aus und dauerte langer. (Autoreferat.

Diversity in naive and treated individuals.

<p>Phylogenetic trees of HBV-WG quasispecies (blue) and consensus sequences (red) from: (<b>a</b>) a treatment-naïve patient (viral titer −10³ IU/ml) and (<b>b</b>) a lamivudine-treated patient (viral titer −10⁶ IU/ml).</p

Detection of co-infections, subpopulations and recombination.

<p>(<b>a</b>) Maximum likelihood trees of HBV-WG quasispecies (blue) and consensus WG sequences from a single patient (viral titer of 10⁶ IU/ml). HBV quasispecies belong to genotypes A and G, while consensus WG sequences (red) obtained at two time-points belong to genotype A. (<b>b</b>) Maximum likelihood tree of HBV-WG quasispecies from a genotype B infected patient (viral titer of 10⁵ IU/ml). Consensus sequence shown in red belongs to a single HBV subpopulation, while the WG quasispecies shown in blue segregate into 2 subpopulations. (<b>c</b>) Maximum likelihood tree of WG quasispecies (blue) sampled from a patient (viral titer of >10⁶ IU/ml) infected with genotype G and recombinant genotype G/A variants. Consensus sequence (red node) belongs to genotype G. Two HBV WG clones, that are genetically distant from the main cluster of genotype G variants, contain genomic regions belonging to genotype A.</p

Repeat amplification of the S-gene fragment from first round PCR products.

<p>Two WG first-round products (C2 and C21) containing two nucleotide changes (indicated in red) were subjected to 40 independent nested PCR amplifications; a sample of 5 identical S-gene sequences amplified from each clone is shown.</p

Primers used for HBV whole genome quasispecies amplification.

<p><b>Note</b>: Each nested primer also contained adaptor sequence tags for sequencing purpose. The forward primers were tagged with SP6 sequence (5′CGATTTAGGTGACACTATAGAAGAGAGGCT3′), and reverse primers with T7 sequence (5′CAGTAATACGACTCACTATAGGGAGAAGGC3′).</p><p>*Overlapping WG primers (WG-F2 to F4) when used in the first round PCR, additional two nested primers - F7 and F8 are to be added.</p

WG-HBV quasispecies amplification of different genotypes.

<p>HBV WG was amplified from samples belonging to genotypes A–G using a universal set of primers. Maximum likelihood tree shows WG quasispecies of genotypes A– E and G. Each cluster in the tree is the WG quasispecies of an individual patient belonging to one genotype.</p

Distribution of mutations along the HBV genome.

<p>(<b>a</b>) Polymorphic positions along the HBV WG quasispecies obtained from 4 patients infected with different HBV genotypes (viral titer of 10³–10⁶ IU/ml). (<b>b</b>) Sliding window analysis of polymorphic regions identified among genotype D variants (each shown with different color) implicated into a horizontal transmission among 4 patients (samples 1–4; viral titer of 10⁴–10⁶ IU/ml).</p

Flowchart of the HBV WG amplification process.

<p>Flowchart of the HBV WG amplification process.</p

PCR primers.

<p>*Numbers within primer names represent the primer positions. An F after the primer position stands for sense primers while R stands for anti-sense primers.</p><p>**SP6 and T7 are tag sequences attached at the 5′ end of all PCR primers used in this study. SP6 and T7 primers were used to sequence PCR fragments.</p

The number of negatively selected sites and specific sites under positive selection.

<p>The number of negatively selected sites and specific sites under positive selection.</p